Entry information : ElaAPx-CcP1 (ElaHyBpox)
Entry ID 13890
Creation 2016-09-20 (Marcel Zamocky)
Last sequence changes 2016-10-10 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2016-10-21 (Marcel Zamocky)
Peroxidase information: ElaAPx-CcP1 (ElaHyBpox)
Name (synonym) ElaAPx-CcP1 (ElaHyBpox)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Eutypa lata    [TaxId: 1287681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ElaAPx-CcP1
start..stop
S start..stop
HCO27APx-CcP02 471 3e-162 21..506 26..515
HEC38APx-CcP02 462 9e-159 22..536 28..549
HC14APx-CcP03 455 5e-156 20..506 25..515
TviAPx-CcP02 394 3e-132 21..502 24..499
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2118..2304 187 N° 2 1478..2012 535 N° 3 1113..1407 295 N° 4 694..1029 336
N° 5 350..625 276  
complement(join(350..625,694..1029,1113..1407,1478..2012,2118..2304))


exon

Literature and cross-references ElaAPx-CcP1 (ElaHyBpox)
Literature Zamocky M. et al. (2016) BMC Genomics 17:763.
Protein ref. GenBank:   EMR71862.1 UniProtKB:   M7T5F5
DNA ref. GenBank:   KB705564.1 (2304..350)
Protein sequence: ElaAPx-CcP1 (ElaHyBpox)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   542 (520)
PWM (Da):   %s   58591.73 (56269.5)  
PI (pH):   %s   4.17 (4.17) Peptide Signal:   %s   cut: 23 range:23-542
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFAATSLFLPLLLLAGQGLTYTWPDVKVDHLESLLYQQQQYHGSLVASDVKYCFLSVFDLDKLRAISGRLAAAEWIRVAYHDMATADVEAGTGGLDASISFETDRDENKGPAFNATMKQLYLFHSARSSMADMIAMAVTLAVGSCSEGKVNVPYRGGRIDATEAGPLGVPEPQQDLDTHTGIFQKQGFNQTEMIGLVACGHSVGGVHGAVFPETVPVLNDTQNEASLQTFDTTGVVFDNGIAVGFTENSTQNALAYGPNLTTRSDHRIFSSDGGNLISRMAQDNDFYLSTCNSLLERMINTVPKEVQLTEVIDPIATKPDYIDIKVNEDGTLFIQGEVTIQGEDIDRDNRHVVVHLKSGDSETEIPTTWNGESLPFHENRPSFDWWGFNVTVPIAQSLSFDVELIDSGDSKLETNGGDGFPLRTDIVPQIAKSCSSTEVFGSSTVSITAAILDEANFDSVVLSVDVPLVQQNSLVPRIEAALVDMEKGEAIEGTGYTLYSGSLDFGAAFQGHISYDVIGHRSSGEDSISEFNLFDALPNCS*

Retrieve as FASTA  
Remarks Complete from genomic (4 introns). Strain=UCR-EL1.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCGGCAACATCATTATTTCTCCCCCTCCTGCTCCTGGCAGGCCAGGGCCTAACTTACACCTGGCCGGACGTGAAGGTCGACCACCTGGAGTCGCTGCTCTACCAGCAGCAGCAG
TACCACGGTTCGCTGGTCGCTAGCGACGTCAAGTACTGCTTCCTATCGGTGTTCGACCTGGATAAGC
GTGAGTACAAAAAAATAAGTCGACATTTTACCTTCCTCGTTCTGTTATAGAAC
CTCCTACAGGGTATGATGAAAAATTGGATACTAACTTGATTTTACCAAAAAGTGCGCGCCATCAGTGGGCGTCTGGCTGCAGCTGAATGGATTCGCGTCGCGTACCACGACATGGCGACG
GCGGACGTCGAGGCGGGGACCGGCGGCTTGGACGCCAGCATCTCGTTCGAGACGGATCGCGACGAGAACAAGGGGCCGGCGTTCAACGCGACCATGAAACAGCTGTACTTGTTCCACAGT
GCCCGGTCTTCGATGGCCGATATGATCGCTATGGCTGTCACGCTTGCCGTTGGCAGCTGCTCCGAGGGCAAGGTCAATGTGCCCTATAGGGGCGGCCGCATCGATGCGACTGAGGCTGGC
CCGCTCGGCGTCCCGGAGCCCCAGCAGGACCTCGACACGCACACGGGTATCTTTCAGAAGCAGGGGTTCAACCAGACGGAGATGATCGGGCTAGTAGCGTGTGGTCATTCTGTCGGCGGC
GTGCATGGGGCCGTGTTCCCCGAGACCGTCCCTGTGCTGAATGATACGCAGAATGAGGCGAGCTTGCAGACGTTTGACACGACCGGAGTTGTCTTCGATAACGGCAT
GTAAGTTAGCTTT
CGCTTCGCGTTAGAATATACCTTTTCATGTGACTGGTCAAACTGACACTCGATACAGAGCAGTGGGGTTCACGGAGAACTCGACGCAGAACGCGCTCGCGTACGGCCCCAACTTGACAAC
GCGGTCCGACCATCGCATCTTCTCCTCTGACGGCGGTAACTTGATTAGCCGCATGGCGCAGGACAACGATTTCTACCTCTCGACCTGCAATAGCCTGCTGGAGCGCATGATCAACACCGT
CCCCAAGGAGGTGCAGTTGACAGAGGTCATAGACCCTATTGCTACTAAGCCGGACTACATCGATATCAAGGTCAACGAAGATGGCACGCTCTTCATCCAAGGAGAAGTTCGG
GTAAGCAA
CTGACCCATTGTATATTCACGATCCACGTTTTTGTATGAAGACCAGCCCACGCTACTTAACTGACCTCTATACAGACGATCCAGGGTGAAGATATCGATCGTGACAACCGTCACGTCGTA
GTGCACCTCAAGTCCGGAGACTCCGAGACTGAGATCCCGACGACTTGGAACGGAGAGAGTCTTCCTTTCCATGAGAACAGGCCCTCTTTCGACTGGTGGGGTTTCAACGTGACGGTCCCC
ATTGCGCAGAGCCTGTCATTTGACGTCGAGCTGATCGACAGCGGCGACTCGAAGTTAGAGACCAACGGAGGAGACGGATTCCCTCTTCGGACGGACATCGTGCCGCAGATAGCCAAGTCC
TGCAGTAGTACTGAGGTCTTTGGTTCCAGCACCGTTAGCATAACTGCTGCC
GTAAGTGATCATCAACATCCCCCTTTACGTGTAACTGAAGATCAGGAATCTGATGATACGTACTACAGA
TCTTGGATGAAGCGAACTTCGACTCGGTCGTCCTCTCCGTCGACGTCCCGCTTGTGCAACAGAACTCCCTCGTACCGAGAATTGAGGCGGCGTTAGTCGACATGGAGAAGGGCGAGGCGA
TAGAGGGCACAGGGTATACCCTCTACTCGGGCTCTCTCGACTTCGGGGCTGCCTTCCAGGGCCACATCTCCTACGATGTGATAGGGCACCGAAGTTCAGGGGAAGATTCCATAAGCGAAT
TCAACCTATTCGATGCTTTACCAAACTGTTCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCGGCAACATCATTATTTCTCCCCCTCCTGCTCCTGGCAGGCCAGGGCCTAACTTACACCTGGCCGGACGTGAAGGTCGACCACCTGGAGTCGCTGCTCTACCAGCAGCAGCAG
TACCACGGTTCGCTGGTCGCTAGCGACGTCAAGTACTGCTTCCTATCGGTGTTCGACCTGGATAAGC
TGCGCGCCATCAGTGGGCGTCTGGCTGCAGCTGAATGGATTCGCGTCGCGTAC
CACGACATGGCGACGGCGGACGTCGAGGCGGGGACCGGCGGCTTGGACGCCAGCATCTCGTTCGAGACGGATCGCGACGAGAACAAGGGGCCGGCGTTCAACGCGACCATGAAACAGCTG
TACTTGTTCCACAGTGCCCGGTCTTCGATGGCCGATATGATCGCTATGGCTGTCACGCTTGCCGTTGGCAGCTGCTCCGAGGGCAAGGTCAATGTGCCCTATAGGGGCGGCCGCATCGAT
GCGACTGAGGCTGGCCCGCTCGGCGTCCCGGAGCCCCAGCAGGACCTCGACACGCACACGGGTATCTTTCAGAAGCAGGGGTTCAACCAGACGGAGATGATCGGGCTAGTAGCGTGTGGT
CATTCTGTCGGCGGCGTGCATGGGGCCGTGTTCCCCGAGACCGTCCCTGTGCTGAATGATACGCAGAATGAGGCGAGCTTGCAGACGTTTGACACGACCGGAGTTGTCTTCGATAACGGC
AT
AGCAGTGGGGTTCACGGAGAACTCGACGCAGAACGCGCTCGCGTACGGCCCCAACTTGACAACGCGGTCCGACCATCGCATCTTCTCCTCTGACGGCGGTAACTTGATTAGCCGCATG
GCGCAGGACAACGATTTCTACCTCTCGACCTGCAATAGCCTGCTGGAGCGCATGATCAACACCGTCCCCAAGGAGGTGCAGTTGACAGAGGTCATAGACCCTATTGCTACTAAGCCGGAC
TACATCGATATCAAGGTCAACGAAGATGGCACGCTCTTCATCCAAGGAGAAGTTCGG
ACGATCCAGGGTGAAGATATCGATCGTGACAACCGTCACGTCGTAGTGCACCTCAAGTCCGGA
GACTCCGAGACTGAGATCCCGACGACTTGGAACGGAGAGAGTCTTCCTTTCCATGAGAACAGGCCCTCTTTCGACTGGTGGGGTTTCAACGTGACGGTCCCCATTGCGCAGAGCCTGTCA
TTTGACGTCGAGCTGATCGACAGCGGCGACTCGAAGTTAGAGACCAACGGAGGAGACGGATTCCCTCTTCGGACGGACATCGTGCCGCAGATAGCCAAGTCCTGCAGTAGTACTGAGGTC
TTTGGTTCCAGCACCGTTAGCATAACTGCTGCC
ATCTTGGATGAAGCGAACTTCGACTCGGTCGTCCTCTCCGTCGACGTCCCGCTTGTGCAACAGAACTCCCTCGTACCGAGAATTGAG
GCGGCGTTAGTCGACATGGAGAAGGGCGAGGCGATAGAGGGCACAGGGTATACCCTCTACTCGGGCTCTCTCGACTTCGGGGCTGCCTTCCAGGGCCACATCTCCTACGATGTGATAGGG
CACCGAAGTTCAGGGGAAGATTCCATAAGCGAATTCAACCTATTCGATGCTTTACCAAACTGTTCATGA

Retrieve as FASTA