Entry information : KflFer01 (Kfl_002580030)
Entry ID 13895
Creation 2016-10-14 (Christophe Dunand)
Last sequence changes 2016-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-14 (Christophe Dunand)
Peroxidase information: KflFer01 (Kfl_002580030)
Name (synonym) KflFer01 (Kfl_002580030)
Class Ferritin    [Orthogroup: Fer001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflFer01
start..stop
S start..stop
PpaFer02 306 1e-105 42..275 32..266
PpaFer03 299 7e-103 56..272 47..264
PpaFer01 296 1e-101 57..270 49..263
AtrFer01 291 4e-100 67..264 40..237
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13687..14036 350 N° 2 13221..13304 84 N° 3 12838..12898 61 N° 4 12532..12619 88
N° 5 12194..12321 128 N° 6 11930..11993 64 N° 7 11691..11743 53  
complement(join(11691..11743,11930..11993,12194..12321,12532..12619,12838..12898 ,13221..13304,13687..14036))


exon

Literature and cross-references KflFer01 (Kfl_002580030)
DNA ref. GenBank:   DF237207.1 (14036..11691)
Protein sequence: KflFer01 (Kfl_002580030)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   275
PWM (Da):   %s   30217.24  
PI (pH):   %s   5.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASAALLSGSAVQLGAPFSSTRLSHCRPGTAATAPLVPAFSAVSWGHATPPLPARRPSAVRAQEVESKEATLTGVVFEPFQEVQGLVKSVPETSQESFARQRFSQAAEAGINEQINVEYNNSYIYHALAAYFDRDNVALPGLAKFFRQSALEEREHAEMFIKYNIRGGRVKLQSILAPQTEYDHSDKGDALYAMELALCLEKLTNEKLLALHKTAEESDDPQMTDFIEGNFLEEVEAIKQVSEYVSQLRRVGKGHGVFHFDLQLQEALEHAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCATCCGCAGCATTGCTCTCTGGGAGCGCCGTCCAATTGGGGGCACCATTCAGCAGCACAAGGTTGTCACACTGTCGCCCTGGCACAGCAGCGACTGCCCCCCTCGTTCCTGCT
TTTAGTGCTGTCTCCTGGGGGCATGCCACGCCGCCACTGCCGGCCCGTCGGCCGAGCGCTGTGCGGGCGCAGGAGGTGGAGAGCAAGGAGGCCACCCTGACTGGCGTGGTGTTTGAGCCA
TTCCAGGAGGTGCAGGGCCTGGTCAAGAGCGTCCCCGAGACATCGCAGGAGTCGTTTGCCCGGCAGCGCTTCTCGCAGGCGGCAGAGGCGGGGATTAATGAGCAAATCAA
GTGAGGGGAG
CTCTCTTGCAAGCTACCTCTTGTCGTTGACCCTGCGAAAAGCATGTGCCATGCTGCCAGCAGCTTGCCCCGCCCGCCTGGCTTCACATGGCATTCGCTCAGTTCTGCTGTCCGCCTGATT
AAATCTGAGTTCCAACCTCCCCCTGCCTTCAAATCTCAGGGTGCAAAAGCAACGGTTTTGTCAATGGCTGGTAGCAGCGCTGCTATGCGCAGGACAGAAACCTTTTTCAGGCAGCTGCAT
CCATAGAGCCGCTGCGCGCCTCAAAATATGGTAATGGTTCTGCATTTTGTGCGGAGTTTTTTGGGGATATTCTCCAAGCCCCTGTTCGTCGCCTGGGCTGCCTGTTGAGCCTGCTCTTTG
TTGGTGCTGCAGCGTGGAGTACAACAACAGCTATATCTACCATGCCCTGGCCGCCTACTTTGATCGGGACAATGTCGCCCTGCCCGGCCTTGCCAAGTGAGTTCCGACCCTAGCTGCTCC
GGGTTCTAGAGAGGGGAGCATCCTTATACCGCCTGCGAGCATTTAGAAATTGACAGCGATTGCGTGGGGGTCAAACTGTCCAACCCCACCCATAATCTGCATCAAGTTGATGCTGCCTTT
ACACTAATTCCAATCTGAATGTGAGTATTTTCTGCAAGTACAGGTCCTTCTGCCTGGAAATGCTGCTGGACAGATTGAACAAGTGGCTTGCTGTGGGCAAGTCTTGGTGCGGCGTGTCTG
TCTTGTCTTCAATTGCATGCGCCAATTGGGATGGCGCTGATGTGCGGTGGTGGTGCAGGTTCTTCCGGCAGAGCGCCCTGGAGGAGCGCGAGCATGCTGAGATGTTCATCAAGTACCAGG
TGAGCACGTGCAGCACGCCCGCCGCCCTGCGCGGGGGCCTGCTGGCCGGCCCCATGCCCCATACGGCTGCAGGTCCACCCAGCAAGAGGGGCTCCAGGCTACCTTGTGCAAGGAGGCTGC
GCGCTGTGTGTGCAAGCTGGTTGTTCAATGTGTTCCTTGAAGGTGCCGCAGGCAGTGGCTCACATGGGCAACATGTCGCCTCTGTGTGTCTGCGCAGAACATCCGGGGGGGCCGCGTGAA
GCTGCAGTCCATTCTGGCACCGCAGACGGAGTACGATCACAGCGACAAGGGGGATGCCCTTTACG
GTGAGCTGGGCCCCATTGGTGGTGTGTGATGTCCCCTCCAGACTAGCAGCAACAA
CAGGGCAATTCGCAAAGCAAGTGCACTTGAATTGGGCCCTACCATCTTCGCCCTTGTGTACGCCGGCATGGCGCCGGCAGGGTGGCGGTGCTTTGCTCGTGCTGTGTGCCATGTGCTGTG
TAGCGCGCGCTGAAGCTGTTGGTGTGTGTGTGCAGCCATGGAGCTGGCGCTGTGCCTGGAGAAGCTGACCAACGAGAAGCTGCTGGCGCTGCACAAGACGGCAGAGGAGTCTGACGACCC
GCAGATGACCGACTTCATCGAGGGCAACTTCCTGGAGGAGCAG
GTCAGGCCACCCCGCACCTCCGGAACATCGGCGGAGTGATCCATGCTGCCTGCACTGGGCACCTGGTTTGCCTGGGC
GAATCAGGGAGCAGGGGGGACAGGTTGTCAGAGTGCCAACCGCCACATTGACGGTGAACTTGAGGGCTGCGGTGCAATGTAGAAATCTAGGCGCATGACCGCTCGTGTGGTGTGCGTGTG
CAGGTGGAGGCCATCAAGCAGGTGTCGGAGTACGTCTCGCAGCTGAGGAGAGTGGGCAAGGGACACGGTGAGGCCTGCAAGCGCACCGCGTCTACAGGCTATCTGTGCTGAATGTGGAGT
CTCTATCGTTTGGATAATGGCTGTTCAGGATCTGAGCTGAGGTTTGTCAATCGCATTGCTATCAATTGAACTTCTATTGGTCTGAAACTTTCTCATCACGTGTTGCTGATTGGCAAACTG
TTCTTTGCATCAGGTGTCTTCCACTTTGACCTGCAACTTCAGGAGGCATTGGAGCACGCGGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCATCCGCAGCATTGCTCTCTGGGAGCGCCGTCCAATTGGGGGCACCATTCAGCAGCACAAGGTTGTCACACTGTCGCCCTGGCACAGCAGCGACTGCCCCCCTCGTTCCTGCT
TTTAGTGCTGTCTCCTGGGGGCATGCCACGCCGCCACTGCCGGCCCGTCGGCCGAGCGCTGTGCGGGCGCAGGAGGTGGAGAGCAAGGAGGCCACCCTGACTGGCGTGGTGTTTGAGCCA
TTCCAGGAGGTGCAGGGCCTGGTCAAGAGCGTCCCCGAGACATCGCAGGAGTCGTTTGCCCGGCAGCGCTTCTCGCAGGCGGCAGAGGCGGGGATTAATGAGCAAATCAA
CGTGGAGTAC
AACAACAGCTATATCTACCATGCCCTGGCCGCCTACTTTGATCGGGACAATGTCGCCCTGCCCGGCCTTGCCAA
GTTCTTCCGGCAGAGCGCCCTGGAGGAGCGCGAGCATGCTGAGATG
TTCATCAAGTACCAG
AACATCCGGGGGGGCCGCGTGAAGCTGCAGTCCATTCTGGCACCGCAGACGGAGTACGATCACAGCGACAAGGGGGATGCCCTTTACGCCATGGAGCTGGCGCTG
TGCCTGGAGAAGCTGACCAACGAGAAGCTGCTGGCGCTGCACAAGACGGCAGAGGAGTCTGACGACCCGCAGATGACCGACTTCATCGAGGGCAACTTCCTGGAGGAGCAG
GTGGAGGCC
ATCAAGCAGGTGTCGGAGTACGTCTCGCAGCTGAGGAGAGTGGGCAAGGGACACG
GTGTCTTCCACTTTGACCTGCAACTTCAGGAGGCATTGGAGCACGCGGCTTGA

Retrieve as FASTA