Entry information : KflFer05 (Kfl_002700240)
Entry ID 13899
Creation 2016-10-14 (Christophe Dunand)
Last sequence changes 2016-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-14 (Christophe Dunand)
Peroxidase information: KflFer05 (Kfl_002700240)
Name (synonym) KflFer05 (Kfl_002700240)
Class Ferritin    [Orthogroup: Fer005]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflFer05
start..stop
S start..stop
CbraFer05 186 9e-59 28..230 25..222
PpaFer02 144 2e-42 28..227 68..262
PpaFer01 141 3e-41 28..223 70..260
PpaFer03 140 6e-41 28..223 69..259
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 112316..112402 87 N° 2 113337..113467 131 N° 3 113761..113844 84 N° 4 114051..114111 61
N° 5 114315..114347 33 N° 6 114515..114569 55 N° 7 114753..114814 62 N° 8 114995..115060 66
N° 9 115203..115266 64 N° 10 115437..115507 71 N° 11 115818..115886 69  
join(112316..112402,113337..113467,113761..113844,114051..114111,114315..114347, 114515..114569,114753..114814,114995..115060,115203..115266,115437..115507,11581 8..115886)


exon

Literature and cross-references KflFer05 (Kfl_002700240)
DNA ref. GenBank:   DF237219.1 (112316..116204)
Protein sequence: KflFer05 (Kfl_002700240)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   260
PWM (Da):   %s   27787.04  
PI (pH):   %s   6.93
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAEGAAMDGAAGREGRPAEEHEETHKGYQPIGEIRACGGLDKLVGPTAGARPASLARMHLDPALDKQLSAAVGVALGTWYNLEAMAVFCLKDTVALPGFTRYFRGRAGQEYREARSIMDYVSQRGGAVQFKIAPPPNSFNHEEKGDALFLMEYALALEKVQNDKYVQLFAAGGSGDPGVQAFVQVRLLGPRAAIIQRTAQCVAQLRRLGKGAGVFVFNAQLLAEQPREESLGNEADQDWSLPGSGACKRAKSGVAQG*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGGGCGCAGCGATGGACGGGGCCGCGGGGCGGGAGGGCAGGCCGGCGGAGGAACACGAGGAGACGCACAAGGGCTACCAGGTGAGGCGATAGCACCACTGATACACTGCATGA
GCCAGCCACAGGGGAGGCGGGCGGCGGGTCTGCGGGCGGAGCGCAAGCCCGCTGGCGACGGCAGGATACCCGCAACATCCCTCTGGCCCAACACAATCGGTTGGAAGTGAACAAAGCTAC
GCTAGTTACAACCTTGTGCATTTTGCGGAAGACTTGGCTCGTTTGAGTGGGTAAATGCTACACTGGTCAAGCTTCCTGTAGCTTAAGGTTTATGACTCAACAATCGGGGCCAAATAAAGG
CTGAGCCTAACGAGAATCTGCAGCTCGAGCGAGTCAATGGCTTATAGAGCCCTTTAGGCACGTGCCTTCTGATAGCGATGGTCTAAAAGACGAAGTTGACTCCGACGTCTCCAAGCTAAG
AAGTTTGGAAGAAAGACACTGGAACTTTGCAAGGCTGCCAATCACCTGCAATTGCATGGTTTTCGCGCGGATTTTACCCTTCTTTCATCACCAAAGGTTGGATACTTTGTTTGTATCAAT
CCGGTCTTTCTGCTTGCTTTAAGCGCTCAAAGCTAGCGAGGGCCATGCTTCCCGACCCGGATCCGACGGGGCCGCGACCTGATTAGTCAACCTGCCTTTCCGTTTTTCCAGCATATGAAG
GATTATGAGGTTGTGAAGAAGAAGAATGTCACGTCTTCCTGACTTCGTGAACAATCCCCTGAAAGTGGCATGAGCTGGTTGACGTCGATTCACCTCGGGTACGGCCCCTTCGTCTGTATA
TTTCTCGACCGCTACCTGTTCCTGTCTTTCTGCTTCAAATTCCAGGTCGACGAAAGGCGTCACTCAGCTTCGCGAGCCGTTCTTTCAAATATTTCTGTCGCCCGCTGATCTCCTTTACAC
ATTCTGCGTTTCGCTTCTGGTTCAAGCAAGCATACACGCGACGTGTCCATGCCTGGTGCAGCCCATCGGCGAGATCCGCGCGTGCGGCGGCCTGGACAAGCTGGTGGGCCCCACTGCGGG
CGCGCGCCCCGCCAGCCTGGCGCGCATGCACCTCGACCCCGCGCTCGACAAGCAGCTCAGCGCCGCCGTCGG
GTAACGCACCGCACTCGCGCTGGCCAGAACTGCTGATTCGACTGACAT
GAGGATCCCTTGCAAAGCGGAAGCCGTCTTCGGCGTGGCCCTGCAACGTCTGTTGCAGCACCACAAGGGCCACCATTCGCGAAGTCACTTCGGCAAAGTGTCGGCAGCAGTCCAGGCGGC
CTTCTCATCCATGCTCTGAAGTGTATACCTCTCACCGGCTCCCCGCGCTGTCTCCATGCCCGCCCGTCCGCGCGCCCGCCCGCCCGCTCGTGCGTTGCCTGACTGCCGCGGTGTGCTGTC
CGCAGCGTGGCCCTGGGCACGTGGTATAACCTGGAGGCCATGGCGGTCTTCTGCCTCAAGGACACCGTCGCGCTGCCCGGCTTCACCAGGTGCGCGCGCGCCACGGCCCACGCCAGTTCT
TATCTCTAACAGCCCGCTGGCTCAAGCAAGGGCAAAGGGCCTTCCAATAAAGTCACGTCTTGCTCTCCTGTGGTCGGCGAGCCACGGTCCCTGGCATCCACCCGGATGCGTCCCGCCGGG
CGTGGAGCGGGCCCTGTTGCTGCAGCCCGCTGACGCTGCCGGCGGTGTTTTGCAGGTACTTCCGGGGGCGGGCGGGGCAGGAGTACCGCGAGGCGCGCAGCATCATGGACTACGTCGTGA
GCAGCGCAAGCCCGCGCCTCGCTGACGCATGTGTCACCCGGGGTCGTGCATCCAAAGGATCCTGCAAGTCTGCCCGTTGTAATGGATTTACACTTATGCGTGCCCGCATTATTTGTCAAG
TGGGGCATTGGCGGCAGAAGTTGTAAGAGCGAGGAGCGGTGGCCCTCAGCGTTGTAACGGGAGCGCTCTGTGGTTGCAGAGCCAGCGTGGCGGAGCCGTCCAGTTCAAAGAGGTACGGCC
TTCGTCCAGCACGGGTAGGGCTGCCGAAACATGGTGCAGGCAGGGGAAGACGCGCCAGATGGGCAGTAGCGTCAATGTGACGGCACGTAGTTGGCTGCAGAGATCAATTGTCTTTCGAAA
TAGTAACGGCCTCATGAGCCTGTTGTGTCGATTCTGCAGATCGCGCCGCCGCCCAACAGCTTCAATCACGAGGAGAAAGGGGACGCGCTCTTTTGTGAGTTCTGCCACCCTCGCCAACTT
CGTAATACAAGTACGGTTGGCGTTCGTCCTGTTCGTTGTACTTTTCAACCCGAACACGCCTTTTTCCTGTCAACCCACGTACGTAAAGCTTCACTGGTGTTAGCTCGGTGCCGGCCGCGG
CCCGCTGTGTGCTGATGCGGGCGGCGTTTGTGCGCAGTGATGGAGTACGCGCTGGCGCTGGAGAAGGTACAGAACGACAAGTACGTCCAGCTCTTCCGGGTGAGTCGACCCCCATGCGCC
CCCATGCGCCCGCAACGGAGACGTACAATAGGGCCCAACTGTACTACCTCTCCCTCGTGACGTCCTGCCTTGCCCTTGCTGGTGTGCTGCTGTGCCTCACCCCTGCATGCTGGCTCACCC
GTCGTGCCGTCACGTGCTTGTTGTGTTTACCGCTGCCAGGCCGCGGGGGGCAGCGGTGACCCAGGCGTGCAGGCGTTCGTGCAAGTACGCTTGCTGGGGCCCCGGGTGAGGACATAATTG
TGTCTGGTGCGCCCCAAGCGAATCCTCTTCTGGCGGGTACATTTGGTAGCACTGTATTTTTGAAGAGTGTTTTTGAAGAGTGTGGCTTCATCTTGGAGTAACACGAAGCTGTCTGGTGTG
GTGGCAGGCGGCCATCATCCAAAGGACAGCGCAATGCGTAGCGCAACTGCGACGTCTTGGAAAAGGAGCAGGTGAGCGAAAAGACGGATTTGGGTCTCGTTGTTCTTTGCTGTGGCAGCC
TTCTCGCTGGTTGGGCGAGGGCACAAGAGGACTGGAGCAATGCTCTCCAGCAAACCCCCATGCAAAACAAAGTTCACGAGGTGTTTAAAAGGCTCTCATCAGCACTGCCGTTGCTTCGCA
GGCGTCTTCGTCTTCAACGCGCAGCTCTTGGCTGAGCAGCCCAGGGAGGAGTCCCTTGGGAACGAAGCCGAGGTGAGCGGTCACAGGCTCGCGGAGGAGCGAAGTCGAAATCACTTGTGG
CAAGGGTCAAGAGGACGGTCGAAACCAGTCCAACGAAGCAACCTACAGCCTAATGGAGACCTCTGATAACGTATGCCATCAATAATCGAGGGCATTGACAGGCTTTGTGAGAATATTCTC
TTTGGTTGTGTGTCATGAGTGGCCACTTTAAGGAGCTCCTAGCTTTTCAAGCAGAACCTCCATAGTATCCAGCTCATGGTAAATTCCATACTGCTTGTTGGTTACTGCGTGCTTTACTCA
ACTCCTTGTACGTCCCTGTTAGGACCAGGATTGGAGCTTGCCGGGAAGTGGCGCATGCAAGCGGGCCAAGTCTGGTGTGGCACAAGGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGGGCGCAGCGATGGACGGGGCCGCGGGGCGGGAGGGCAGGCCGGCGGAGGAACACGAGGAGACGCACAAGGGCTACCAGCCCATCGGCGAGATCCGCGCGTGCGGCGGCCTG
GACAAGCTGGTGGGCCCCACTGCGGGCGCGCGCCCCGCCAGCCTGGCGCGCATGCACCTCGACCCCGCGCTCGACAAGCAGCTCAGCGCCGCCGTCGG
CGTGGCCCTGGGCACGTGGTAT
AACCTGGAGGCCATGGCGGTCTTCTGCCTCAAGGACACCGTCGCGCTGCCCGGCTTCACCAG
GTACTTCCGGGGGCGGGCGGGGCAGGAGTACCGCGAGGCGCGCAGCATCATGGACTAC
GTC
AGCCAGCGTGGCGGAGCCGTCCAGTTCAAAGAGATCGCGCCGCCGCCCAACAGCTTCAATCACGAGGAGAAAGGGGACGCGCTCTTTTTGATGGAGTACGCGCTGGCGCTGGAGAAG
GTACAGAACGACAAGTACGTCCAGCTCTTCCGG
GCCGCGGGGGGCAGCGGTGACCCAGGCGTGCAGGCGTTCGTGCAAGTACGCTTGCTGGGGCCCCGGGCGGCCATCATCCAAAGGACA
GCGCAATGCGTAGCGCAACTGCGACGTCTTGGAAAAGGAGCAG
GCGTCTTCGTCTTCAACGCGCAGCTCTTGGCTGAGCAGCCCAGGGAGGAGTCCCTTGGGAACGAAGCCGAGGACCAG
GATTGGAGCTTGCCGGGAAGTGGCGCATGCAAGCGGGCCAAGTCTGGTGTGGCACAAGGATAA

Retrieve as FASTA