Entry information : PpaFer01 (HYPADRAFT_181672)
Entry ID 13900
Creation 2016-10-14 (Christophe Dunand)
Last sequence changes 2016-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-14 (Christophe Dunand)
Peroxidase information: PpaFer01 (HYPADRAFT_181672)
Name (synonym) PpaFer01 (HYPADRAFT_181672)
Class Ferritin    [Orthogroup: Fer001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaFer01
start..stop
S start..stop
PpaFer03 419 3e-150 20..263 19..262
PpaFer02 395 7e-141 20..262 21..260
MpFer02 315 3e-109 3..262 1..258
ThasFer01-1 311 7e-108 46..262 35..258
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1383250..1383578 329 N° 2 1382832..1382915 84 N° 3 1382661..1382721 61 N° 4 1382458..1382545 88
N° 5 1382284..1382345 62 N° 6 1382054..1382119 66 N° 7 1381864..1381927 64 N° 8 1381321..1381358 38
complement(join(1381321..1381358,1381864..1381927,1382054..1382119,1382284..1382 345,1382458..1382545,1382661..1382721,1382832..1382915,1383250..1383578))


exon

Literature and cross-references PpaFer01 (HYPADRAFT_181672)
DNA ref. GenBank:   NW_001865307.1 (1383578..1381321)
Cluster/Prediction ref. Genebank:   5925135
Protein sequence: PpaFer01 (HYPADRAFT_181672)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   263
PWM (Da):   %s   29263.71  
PI (pH):   %s   6.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVMARAVVAGSVNTSAGAVLATRSGDQGSLSASCKSVVVRSRSLVSQSRVVAVRASGQEFATKTLSGVVFEPFSEVQDQLVKVTTSPQLESLARQRFAPSCEAAINDQINVEYNVSYVYHALYAYFDRDNVGLPGFAQYFKHASDEEREHAEKLMRYNQRGGKVKLQSIVMPLMEFDHHEKGDALYAMELALALEKLTNEKLFQLHAAADANDHQMTEFIEREFLTEQVEAIKKVSEYVSQLRRVGQGHGVYHFDLQLQEA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGATGGCGCGCGCAGTGGTGGCGGGGTCCGTTAACACATCGGCTGGGGCCGTGCTGGCCACAAGGAGTGGTGACCAGGGGAGTTTGAGCGCTAGCTGTAAGAGTGTGGTGGTGCGA
AGCAGGAGTCTAGTGTCGCAGAGTAGAGTAGTCGCTGTGAGAGCCTCTGGTCAGGAGTTCGCGACGAAGACATTATCGGGAGTGGTGTTTGAGCCCTTCAGTGAGGTGCAGGATCAGCTT
GTGAAAGTTACTACATCGCCGCAGTTGGAGTCGTTGGCTCGCCAGCGGTTCGCCCCTTCTTGTGAGGCTGCCATCAATGACCAGATCAA
GTATAGCTTCGTTCTGCATCGTTTTTTTGTC
TGTTTCTATTTTTATTTTTATTTGTATCTTGTTTGTCATTATATCTTACCGAGGTTTTAAGGTGTACTAAAATTGAGAAGTGTCAAGGGCGCTTCGATGCTGCTTTTTATTTCGAGAGGT
CTTGGTGACCAGGAATAGTAGAGTGAAACCGTAGTCGTCTTTAAATGTTTGTTCTACGTGTCATCAGACGTTTTCTTGTTTCTTCGAAACTCTAAAACCGATATTGCATCACGCTGTCTC
ACGTGCTGATATGCTTCTCAGTCGCTGTAACCTGTGTCGTCCTATTCTTTTATCGCTTTGCAGTGTGGAATACAACGTTTCATACGTCTACCATGCTCTTTATGCCTACTTCGATCGTGA
CAATGTAGGACTTCCAGGCTTTGCGCA
GTAAGTTCACAATTTTATTTACAGTCTTTGTGTTTGTCCTTGTGACTTTCTTTATTAGATGATTGGAACTAGATATCTGAGTAACTTGTGGAT
TCTGAAACCTGTTGCAGGTATTTCAAACATGCGAGTGACGAAGAACGTGAACATGCTGAGAAATTGATGAGATACCAGGTTCGTTTTGTCTCCCGCCTTTCTTTTTAGCTCTTTGTATTA
TTTTCCTGGTAATTGACGGTTGACTGATTGGATTTACTCGATCTTTTGCATTTTGGGTTCATGTGCTACCCAGAACCAACGCGGAGGAAAAGTCAAGTTGCAATCAATTGTCATGCCTTT
GATGGAGTTTGACCATCATGAGAAGGGAGATGCTCTTTATG
GTCAGTAACTTTTCGGATTGACGCGCTTATTTGTGATCTTTACACGTCCCAGACTACTTGCTTCGTGTTTTGGTGTCTG
TATGTAACTACAATGTGCTGGTGACCTGCTCAGCTATGGAGTTAGCACTTGCGCTGGAGAAATTAACGAACGAGAAGCTTTTTCAGTTGCATCAGGTAAAATTTTAGTTTAGATTCTTGG
ATGCAGGTTCTCTTTTTTATATTCACACTCGAGCTTTATCGTAAAGCTATGGTAATTCCGTTATTTTAATAGAGTCAGCCATGATTATTATGCTTTACTAAACGATTATTAACAACGTCA
GTATCCGTGACTTTGCCAGGCTGCCGCTGATGCCAATGATCATCAAATGACCGAGTTTATTGAAAGAGAGTTCCTCACAGAGCAGGTACTTTCACACTCTTAAACCTTCAGAGTGTTGCG
TGTTGCATCTCCGTTGAAATGACATCTTAAAAAATTTGCCTCTTTATCAATCTATTCGCTTTTCTAAGTAGTCGAATGTTGGTGATTGAAGGTCGAAGCAATTAAGAAGGTGTCAGAATA
TGTCTCTCAGCTACGAAGAGTTGGGCAAGGACACG
GTAAACTTCTTACTTTTGCTCAAGGATAAGTTTGTATACTGTTCTACTGTGGCTGATTGGGCAATAACAATGGAATTATTCAAAT
TCTTGAAATTCCCTAATTTTATGTCGAATGTAATGCTAGCAATTGAATCTGGAAGCGTTTTCAGTCATTGTTAATATAATGCTTCACATAACCTTAAACTGGTCATTATTATAATCCTTT
TGACCATGAATGTTAGCAGTAATCTATACAACATATTTGCTGGGCAGAACACATGTATCAGGTGTAACCATGGCATTACGTACAACGGATTTGATAGTGTTCCTTGTATGATCTGACCAA
TTCCCGCATTAGGCACCGTTCGTTGGCACCCCGATGCAGTGAGCGTGGCGAGAAGGGGCCGCTACCTTGTGCTTCATCGTGTGTTATTAATAGTTCATCATGATATTTCTGCCAATGTTT
TAATTTTTGTTGTGCAAGTGTGAGATCTGACAGCCTTTGGTCTGGCCTTGCTTATTACAGGTGTTTACCACTTCGATTTACAACTTCAGGAAGCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGATGGCGCGCGCAGTGGTGGCGGGGTCCGTTAACACATCGGCTGGGGCCGTGCTGGCCACAAGGAGTGGTGACCAGGGGAGTTTGAGCGCTAGCTGTAAGAGTGTGGTGGTGCGA
AGCAGGAGTCTAGTGTCGCAGAGTAGAGTAGTCGCTGTGAGAGCCTCTGGTCAGGAGTTCGCGACGAAGACATTATCGGGAGTGGTGTTTGAGCCCTTCAGTGAGGTGCAGGATCAGCTT
GTGAAAGTTACTACATCGCCGCAGTTGGAGTCGTTGGCTCGCCAGCGGTTCGCCCCTTCTTGTGAGGCTGCCATCAATGACCAGATCAA
TGTGGAATACAACGTTTCATACGTCTACCAT
GCTCTTTATGCCTACTTCGATCGTGACAATGTAGGACTTCCAGGCTTTGCGCA
GTATTTCAAACATGCGAGTGACGAAGAACGTGAACATGCTGAGAAATTGATGAGATACCAGAACCAA
CGCGGAGGAAAAGTCAAGTTGCAATCAATTGTCATGCCTTTGATGGAGTTTGACCATCATGAGAAGGGAGATGCTCTTTATG
CTATGGAGTTAGCACTTGCGCTGGAGAAATTAACGAAC
GAGAAGCTTTTTCAGTTGCATCAG
GCTGCCGCTGATGCCAATGATCATCAAATGACCGAGTTTATTGAAAGAGAGTTCCTCACAGAGCAGGTCGAAGCAATTAAGAAGGTGTCAGAATAT
GTCTCTCAGCTACGAAGAGTTGGGCAAGGACACG
GTGTTTACCACTTCGATTTACAACTTCAGGAAGCATAA

Retrieve as FASTA