Entry information : PpaFer02 (PHYPADRAFT_210187)
Entry ID 13901
Creation 2016-10-14 (Christophe Dunand)
Last sequence changes 2016-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-14 (Christophe Dunand)
Peroxidase information: PpaFer02 (PHYPADRAFT_210187)
Name (synonym) PpaFer02 (PHYPADRAFT_210187)
Class Ferritin    [Orthogroup: Fer001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaFer02
start..stop
S start..stop
PpaFer03 409 2e-146 24..262 22..263
PpaFer01 405 6e-145 1..260 1..262
ThasFer01-1 318 1e-110 28..266 30..264
AtrFer01 311 5e-108 50..255 33..237
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1835831..1836153 323 N° 2 1835134..1835217 84 N° 3 1834981..1835041 61 N° 4 1834675..1834762 88
N° 5 1834504..1834565 62 N° 6 1834211..1834276 66 N° 7 1833818..1833881 64 N° 8 1833589..1833647 59
complement(join(1833589..1833647,1833818..1833881,1834211..1834276,1834504..1834 565,1834675..1834762,1834981..1835041,1835134..1835217,1835831..1836153))


exon

Literature and cross-references PpaFer02 (PHYPADRAFT_210187)
DNA ref. GenBank:   NW_001865315.1 (1836153..1833589)
Cluster/Prediction ref. Genebank:   5926331
Protein sequence: PpaFer02 (PHYPADRAFT_210187)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   268
PWM (Da):   %s   29093.46  
PI (pH):   %s   4.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIAGTAAAGAVTTTATVASVGSRNAVAGSCSSSSRGVAVRAWSSSRFVGVRASNNDVSTKTVTGVVFEPFSEVQDQLVKVTTSPQLDSLARQRFSASCEAAINEQINVEYNVSYVYHALFCYFDRDNVALPGLAQYFKAASDEEREHAEKLMRYNQRGGRVKLQSIVLPEMEFDHPEKGDALYAMELALALEKLTNEKLLQLHAASDANDPQMTDFVEGEFLTDQVEAIKNVSEYVAQLRRVGKGLGVYHFDLQLQEEQNGAAAA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATAGCGGGTACTGCTGCGGCCGGGGCCGTGACGACGACGGCGACGGTGGCTTCTGTAGGCTCGAGGAACGCTGTAGCTGGGAGTTGCAGCAGTAGCAGCAGGGGTGTAGCGGTA
CGAGCTTGGTCTTCGAGTAGATTTGTTGGTGTGAGAGCCTCCAACAACGATGTGTCGACGAAGACGGTGACGGGAGTGGTGTTTGAGCCCTTCAGTGAGGTGCAGGATCAGCTTGTGAAG
GTTACCACGTCGCCACAATTAGACTCGTTGGCTCGTCAGCGCTTCTCAGCTTCTTGCGAGGCTGCCATCAATGAACAAATCAA
GTAATGCTTCAACTTCTTTACTTCTTTACTTGAATTT
CTTCTATCTGTCCGAGCAGTGCTTGGTTACCACGTATTTAAGCCTCGTATTGTAGTGGTGACAATGCTCGAGCGCGGAACTAGGAGTCTTTTGGTCTTGGAATGAAATCTTCTGTTTAGA
TCATATAGATTGAGTATCATAAAAAGCGTTGTCGTGTGGTCGTGTAATTCGGTTAAGTTCTGGTTATAGGTATTTTCAGTGTGTAGGGTAACTCTTAAGTTAATGTGGGCGTAGTTTATT
AGAGGCGGAAGTGTTTGGGTCGGGTGTGTCGAGCTTTGGAGTGTTAATCGTGGGAGAAGATATTTTGCTCACTTTCATTGAGTTTTATTTTTCAGTCCTACTTCATAGTTCTCTTCCCTT
AAGCGTGTGGAGTTTTCTGAAAGATCACGTTGATACTTCCACGAGCCACGGAACTATGTATGACTGAACGGCGTACTGTTAGTTTCTGGTAGAGCGTAGTGAGCGTTTTGATTTATGGAG
CTTGTTAGGTGCAGCGCCACACTAGCACTGAAGAAGTTTGGTCAACCTCGCGTAATGTGTTACTGACATTGTACTTGACGTACTTTGTTTTTGCAGTGTGGAGTACAATGTTTCTTATGT
TTATCACGCCCTATTTTGCTATTTCGACCGTGACAATGTGGCTCTTCCAGGTCTTGCGCA
GTAAGTATTGCTAAGCTACTCCCCTTTATGCTTCTTTTTCAGATATTAGATAGAGCAGTG
GACTAACTGGTATATTGCGGAAACGTTTGCAGGTACTTTAAAGCCGCTAGTGACGAAGAACGTGAACATGCTGAGAAATTGATGAGATACCAGGTATGATCTATGTGGGAAAAGTATACT
CTGACCTGCGGTCATATTTCTTTGATTCGCTTTGGATACCAGTGTTATCCATTCTTGTCTCGGTTTTAGACGTTGCTCTTCCATTACGGTCATAGTCTGGTCTGCAGTGTAGCATTTGAG
GTCATGGTTGTTGTGAAGAATTGTGGTTCGGATGTTATCAGTGATGTATTACATGGTGGTGCGCATTTCAGAACCAGCGAGGAGGAAGAGTCAAGTTGCAATCTATTGTTTTACCTGAGA
TGGAATTTGACCATCCTGAAAAGGGAGATGCTCTTTATG
GTAGTAAACTCTTTGAATGACAGAATCATTTGTAGTATGTTTATTGTGAACTGCATTCTATCCTTTTTGCAACATTCGGAT
ATCTAACCATGCTCGGTATGCTTTTCAGCTATGGAGTTGGCGCTTGCATTGGAGAAGTTGACTAACGAGAAGCTTTTGCAGTTGCACCAGGTAAATTACGCTTTCTTTTAAGGTCTCGTC
ACAAACTTTTAATTAGCGTTGCAGTGGTTTTTAGCTAGTATGTATCTGATGATCTTAAAAATTCCTCAGCATCGATATTTACCTTTAGTGAGAACTAGAATCAAATAGATTTTTTAACTA
CTTAAGCAAGTCGTGTTATATAGGTTGAATGCAGTCACTATGAGAATACTAACAGGTCTTTCTTGTGGATTGGACAGGCTGCCTCTGACGCCAATGATCCCCAGATGACTGATTTTGTTG
AAGGGGAGTTTCTCACAGACCAG
GTATTGCCATTTGCACTTAATGCACAAAGTCACTGTGACCCAGAGCTTAACGACATCGTGTTGTTATAAGATGGAGTGATTGTTAAGTTTTTGCGGT
TGTAGTACTTAGTACGTGGTAAAAAGGTTGACGTGAGTAGTAGGGTTTTGGTAATGTCTTCGGTTCTCTATCAACAGCCTTACTTATTTGTCTTTGTGACGATCTTTGATAATTTAATAG
CGAACCTATAAGATAGAAGCTACATACCTTTTGTTATGCCTTTTAGGAGCAGATTACATTATACAATATGATTTCTCCACTTTACTAATTTAGAGAATTTGGGTGATTAAAGGTTGAAGC
AATCAAGAATGTGTCCGAATATGTGGCTCAGCTACGGAGAGTTGGGAAAGGGCTTG
GTAAGATCTTCAAATCCGGTCATGTTTGTGATTATGATAGTAACTATACTTATGACAATTCTAA
ATCAGTCTCATCTGTCTGTGATTGAACGTAAGTTAAGAGCTTTGTATTTTGTGTTCACCTACATCAGTGATGTCTTGGTAAACTCATTTCTGCTATGTGTATACAGGTGTCTACCACTTC
GACTTGCAACTACAGGAAGAACAAAATGGCGCTGCTGCAGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATAGCGGGTACTGCTGCGGCCGGGGCCGTGACGACGACGGCGACGGTGGCTTCTGTAGGCTCGAGGAACGCTGTAGCTGGGAGTTGCAGCAGTAGCAGCAGGGGTGTAGCGGTA
CGAGCTTGGTCTTCGAGTAGATTTGTTGGTGTGAGAGCCTCCAACAACGATGTGTCGACGAAGACGGTGACGGGAGTGGTGTTTGAGCCCTTCAGTGAGGTGCAGGATCAGCTTGTGAAG
GTTACCACGTCGCCACAATTAGACTCGTTGGCTCGTCAGCGCTTCTCAGCTTCTTGCGAGGCTGCCATCAATGAACAAATCAA
TGTGGAGTACAATGTTTCTTATGTTTATCACGCCCTA
TTTTGCTATTTCGACCGTGACAATGTGGCTCTTCCAGGTCTTGCGCA
GTACTTTAAAGCCGCTAGTGACGAAGAACGTGAACATGCTGAGAAATTGATGAGATACCAGAACCAGCGAGGA
GGAAGAGTCAAGTTGCAATCTATTGTTTTACCTGAGATGGAATTTGACCATCCTGAAAAGGGAGATGCTCTTTATG
CTATGGAGTTGGCGCTTGCATTGGAGAAGTTGACTAACGAGAAG
CTTTTGCAGTTGCACCAG
GCTGCCTCTGACGCCAATGATCCCCAGATGACTGATTTTGTTGAAGGGGAGTTTCTCACAGACCAGGTTGAAGCAATCAAGAATGTGTCCGAATATGTGGCT
CAGCTACGGAGAGTTGGGAAAGGGCTTG
GTGTCTACCACTTCGACTTGCAACTACAGGAAGAACAAAATGGCGCTGCTGCAGCTTAA

Retrieve as FASTA