Entry information : KflGOX01 (Kfl_005400100)
Entry ID 13904
Creation 2016-10-14 (Christophe Dunand)
Last sequence changes 2016-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-14 (Christophe Dunand)
Peroxidase information: KflGOX01 (Kfl_005400100)
Name (synonym) KflGOX01 (Kfl_005400100)
Class Glycolate Oxidase    [Orthogroup: GOX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflGOX01
start..stop
S start..stop
PpaGOX01 586 0 7..367 5..365
PpaGOX02 581 0 7..361 5..359
HaGOX09 573 0 7..367 2..362
BstrGOX03 573 0 7..364 2..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 58942..59093 152 N° 2 58617..58741 125 N° 3 58368..58414 47 N° 4 57808..57885 78
N° 5 57330..57454 125 N° 6 57078..57144 67 N° 7 56522..56584 63 N° 8 56253..56322 70
N° 9 55800..55900 101 N° 10 55490..55594 105 N° 11 54994..55197 204  
complement(join(54994..55197,55490..55594,55800..55900,56253..56322,56522..56584 ,57078..57144,57330..57454,57808..57885,58368..58414,58617..58741,58942..59093))


exon

Literature and cross-references KflGOX01 (Kfl_005400100)
DNA ref. GenBank:   DF237489.1 (59093..54994)
Protein sequence: KflGOX01 (Kfl_005400100)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   378
PWM (Da):   %s   41042.6  
PI (pH):   %s   9.22
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MENLMEEITNVMEFEGIAKKKLPKMVFDYYASGAEDQYTLKLNRSAFEEFRLKPRIMVDVSKQDLSTTVLGHRLSMPIMVAPTAMQKMAHPGELATARAAAAMGTATLSSWATSSVEEVNSVGAGLRFFQLYVYKNRAVVEQLVRRAERAGFKAIALTVDTPRLGRREADIKNRFVLPPGLTLKNFEGLDLGKMDTADSGLASYVAGQIDRSLTWKDIQWLQTITKLPIFVKGVMSAADTKLAVRHGAQGIIVSNHGARQLDYVCATIQALEVVIAAEGKIPVFLDGGVRRGTDVLKALALGAQGVFIGRPVVYGLASAGEAGVKKVLQMLRDELELAMALVGCPNVKDINRSIIVTPQDTIREAQAGQATARL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAACCTGATGGAGGAGATCACCAATGTGATGGAGTTTGAGGGGATTGCAAAGAAGAAGTTGCCTAAGATGGTTTTTGACTACTATGCATCTGGAGCGGAAGATCAGTACACATTG
AAGCTCAACCGGTCTGCATTTGAGGAGTTCAG
GTGGGTTGCGGTTGTCACAACCTTTGGCAGAATTTCTGAGGACCGTCAGGGTCTGCTGCCTTTTGCTAGGGTTTGTGTCAACGAACTC
ATCATTGCATCATGCCCTGCATTGTTTGTAAAAGGTTGTGGATGCTAAGTATTCTTGCACCAAGGCCCGCACCCCGCAAGCTCTGCAGAGGTTCGTTCCATTGGTTGCGCAGGCTGAAGC
CCCGCATCATGGTGGATGTGAGCAAGCAGGACCTTAGCACCACAGTGCTGGGTCACCGGTTGAGCATGCCCATCATGGTTGCACCTACGGCCATGCAAAAGATGGCGCATCCAGAGG
GTG
AGTGCACGCGCACTCCTATCCTTTTCTCTTTAATAGGAAAGAGGGCGCGAGTGGGCCGAGGATTTGTCAGGATTCTGACTGTAAAATAGCTCAGCTACTGGGGTTCAGCATCCCTAAATA
GCGGAACTAAATAATTTGAATAAGAATACGCAGGAACACTTACTTCACCTTCTCCTGATTTTTTGTCTGCTTTGTGCAGGTGAGCTTGCCACTGCACGTGCCGCTGCTGCAATGGGAACA
GCCATG
GTGAGTAGGTTGGACTTGCTACAGATGCTAACCTTCTGAATGCTGGCACAACGCTTTGAGTTCTGATCATCATTTCGGCATCTTCGCGGTGTATGCTTGGTCATACGCGCTTTG
CCCTTGGCGTTGCTTTTTGCATTAGCAAGACAGCAAATACCTTGCTTTGAAAGCATGCCTGCTTATGTATTTCAGCATTGCAAGCAAACGCTCGTTGCGAGCTCCAGGAAAGCAACTACC
ATGTATCTTCTCCATCTAGGTTGTTGGAATCATCTGCTCTTACCGTCGTGCACTTCTCATTACTCAATCCTTATTAGTGTTGAACGGCCGCAGCTGCAAGTCAGCAGCAGCAGGCTGGTG
AGTTTCTCACCGCAGACTTAGCATACCGTATACTTATCTTGGTACACACCTGCTCCAACATTAGGGACTCTTTATTGCCTCCCTGGCATGCTTCTTGCTTACCTTCCTTCTGTCCCGCAC
TTCTCCAGACGCTGTCATCATGGGCCACGTCCAGCGTGGAGGAGGTGAACTCGGTGGGGGCAGGGCTGCGCTTCTTCCAGCTCTATGTAAGCACTGGGGCCGCTTTCATGAGACCTACTT
TGCTCCGCCCCGTGTCACCTCATTCCGACCATTTCATTCTTGCAGTGTCGGAGGAAGTATTAGGGGTGACGTGCTGATTAATACGTCGGGGAGTTGTGTTGTACAGAACTGAGCACGCAC
TTTTACATGATTTCCTTTGCTTGTGCTATTGCCAGCAACGACGTTCCTCATGTGGAGGGCGCACTTCGTTATATGTCTCGGAACCACATGTGCTTACGCTGTCTTTTAACAGGTCTTGTT
GATGGGCGTTTGGAAAGAGGCTCTTCCAGCGAACACCAATACACGGCTGTAAAAGTGACCTCTATCCAATATGCTGCAGGTGTACAAGAACCGTGCCGTGGTCGAGCAGCTGGTGCGCCG
TGCTGAGCGGGCCGGGTTCAAGGCGATTGCGCTCACTGTGGACACGCCCCGCCTGGGCAGGAGAGAAGCAGACATCAAGAACAG
GTCAGGCGCCACGCAATGCATCCTGTCTCCAGCTAT
GAGGGCAACTTGACCAGGTCGCTTGACAATCTTCCCGAATCGATGCTGGCAAGTCTGCTAGATGGTTCTGGCCCTGAAGCCTGTGTGATCAAGGGTCGTTCATGCTTGCTCGATGGTGCG
CTTCTGAATGCGACCTATCTTGGCTTCAGGTTTGTCCTGCCCCCGGGCCTGACTCTGAAGAACTTCGAGGGTCTGGACTTGGGCAAGATGGATCAGGTGGGTGCCCCATTTGTGTTCCGC
CACCAGACAGTCTGCCTTTTCTCAGCTACTTGCGGAAGTTCAACGAGATACCCCCTGGACACACGATGGCAGTAGCACGTACTTCCTTCATGACTCCATTCTCATGAGGTCTTCGCGGCG
GCTCGGAAGGAACCAATGGGCACATTGCCCTCTTAGGATTGTGCCGAGGCGCCTGTTCTCAGCAGGGGGAGCACATAGCCTCCTCAAGAGGCACATTTACGTCATGTTGCTTCACGTTTA
CTTAAGTTTATGACTAGAAGAGATCAGGGGCTATCCACAGCGGATCGGTGGGTAGCTTCTGATGGATAGCTCCCAGCACATTTGCTTTGGCGCTTCGCGTTGAACAGTGCCAAGCAATCG
CTGGAGTTGAAGATTGTGAGCGAGTTAACAAACTGGGTTCTCTCACGAGCTTGGCTGCACCTGCGACTGCCTCTGTGGTTCATTGAAGGTTTTTGGATTCCTTTCACAGACTGCCGACTC
CGGCCTGGCCTCATATGTTGCGGGCCAGATCGATCGGTCCCTCACCTGGAAG
GTACGCCTGGCCCCCTGATACCCACAAAAACTTCCGGAACCAACGACTTTAGGATCTTCCCGCCGTAG
GCGGCAGACGTCTGCACCTGTCTTTGAACTGCTCGATTTGCTTGCCTTCTGTGTTCAGATCAGCAGCACTGTGCTTGTCGTCCGGACATCTGGCGGGAGTTTTGAGAGATGGGCTTTTTT
TCCGAGTGCAGGACATCCAGTGGCTGCAGACCATCACCAAGCTGCCCATCTTCGTGAAGGGCGTCATGAGCGCGGCAGACAGTGAGTGACCACGTCATTTTAATGCCAGGCACACCCCTT
GATTGTTGGGCAAAGCAACATTTTGTACGAGTCTGTCTACAGCAACTGCTGCCCGGCAAAGCAACATTTTGTACGAGTCTGTCTACAGCAATTGCTGCCATAACGACCGGTCTTCTGCAG
ATCACCAGCATCTTGGAACGCATCAGGCATAAGCCGAGGAAGCTACTTGTCTTGGGGCAGCCTGGTTCGATTGCACTAGGAGGGAACACGAGGGTAGAAGCAGCTACTGCGAAGATGTGG
TGGAAAGCATCTTACCAGTCTGTGCATACCACTTTGCATCGTCAGCTCCTGACCAGGCCGCATTTTGCTGCAGCCAAGCTGGCCGTCCGCCATGGGGCGCAGGGCATCATCGTGTCCAAC
CACGGCGCGCGCCAGCTGGACTATGTCTGCGCCACCATTCAGGCGCTCGAGGAG
GTATTTAGTCCCGCCGTCTCCTCTAGAAAGCCTCTGTAAAAGGCCACAGATTGTAATATGGCCCTG
GCCCGGCCGTAACATAGAATTCTGCATTGAGGCACACTCACTTTCGGATCTGTGCGAATCATGAAGGAGTACGCTGTGATGGATCTGGTTTGTCGTGCGCTGTTTCTCCGGCTGCCAACT
CTGGCAGGGCTGCCTGCAGGTGGTGATTGCTGCGGAGGGCAAGATTCCGGTGTTCCTTGACGGAGGCGTCCGGAGGGGCACGGACGTGTTGAAAGCCTTGGCCCTGGGGGCCCAGGGAGT
CTTC
GTGAGTTCCGTCCCCAAGCGGACTCTATCAAACTTACCCGTCCTGTTTAAGAGCAATTAATGAAACTGTCGGGCATTTCAGTGGTGCTTTGATGCAGTCTACTTTGGCCCGTGTCC
GGACGGACTCAGGTGATGATAAGGCTCTGGTTGGGCATGTAGACGGTTGAGATTCTGGTATTTGTGCGCTTGATTCTTTCCAGATGGCTTTCACATACTGGTTCAATTGTGACGATCAGT
GCTTTTTTCCAACAACCGCGTGTGCTGCTCTTGAGACGTCGTTGCCTCTCTCCCAGATTGGCCGCCCTGTCGTGTACGGGCTTGCCAGCGCGGGCGAGGCTGGCGTGAAGAAGGTGCTGC
AGATGCTCCGGGACGAGCTGGAGCTGGCCATGGCCCTCGTGGGCTGCCCGAATGTCAAGGACATTAACCGGTCCATCATCGTTACCCCCCAGGATACGATCAGGGAAGCTCAGGCTGGCC
AGGCCACAGCTCGCTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAACCTGATGGAGGAGATCACCAATGTGATGGAGTTTGAGGGGATTGCAAAGAAGAAGTTGCCTAAGATGGTTTTTGACTACTATGCATCTGGAGCGGAAGATCAGTACACATTG
AAGCTCAACCGGTCTGCATTTGAGGAGTTCAG
GCTGAAGCCCCGCATCATGGTGGATGTGAGCAAGCAGGACCTTAGCACCACAGTGCTGGGTCACCGGTTGAGCATGCCCATCATGGTT
GCACCTACGGCCATGCAAAAGATGGCGCATCCAGAGG
GTGAGCTTGCCACTGCACGTGCCGCTGCTGCAATGGGAACAGCCATGACGCTGTCATCATGGGCCACGTCCAGCGTGGAGGAG
GTGAACTCGGTGGGGGCAGGGCTGCGCTTCTTCCAGCTCTAT
GTGTACAAGAACCGTGCCGTGGTCGAGCAGCTGGTGCGCCGTGCTGAGCGGGCCGGGTTCAAGGCGATTGCGCTCACT
GTGGACACGCCCCGCCTGGGCAGGAGAGAAGCAGACATCAAGAACAG
GTTTGTCCTGCCCCCGGGCCTGACTCTGAAGAACTTCGAGGGTCTGGACTTGGGCAAGATGGATCAGACTGCC
GACTCCGGCCTGGCCTCATATGTTGCGGGCCAGATCGATCGGTCCCTCACCTGGAAG
GACATCCAGTGGCTGCAGACCATCACCAAGCTGCCCATCTTCGTGAAGGGCGTCATGAGCGCG
GCAGACA
CCAAGCTGGCCGTCCGCCATGGGGCGCAGGGCATCATCGTGTCCAACCACGGCGCGCGCCAGCTGGACTATGTCTGCGCCACCATTCAGGCGCTCGAGGAGGTGGTGATTGCT
GCGGAGGGCAAGATTCCGGTGTTCCTTGACGGAGGCGTCCGGAGGGGCACGGACGTGTTGAAAGCCTTGGCCCTGGGGGCCCAGGGAGTCTTC
ATTGGCCGCCCTGTCGTGTACGGGCTT
GCCAGCGCGGGCGAGGCTGGCGTGAAGAAGGTGCTGCAGATGCTCCGGGACGAGCTGGAGCTGGCCATGGCCCTCGTGGGCTGCCCGAATGTCAAGGACATTAACCGGTCCATCATCGTT
ACCCCCCAGGATACGATCAGGGAAGCTCAGGCTGGCCAGGCCACAGCTCGCTTGTAA

Retrieve as FASTA