Entry information : KflGOX02 (Kfl_002840030)
Entry ID 13905
Creation 2016-10-14 (Christophe Dunand)
Last sequence changes 2016-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-14 (Christophe Dunand)
Peroxidase information: KflGOX02 (Kfl_002840030)
Name (synonym) KflGOX02 (Kfl_002840030)
Class Glycolate Oxidase    [Orthogroup: GOX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflGOX02
start..stop
S start..stop
KflGOX01 530 0 3..378 5..378
PpaGOX02 496 2e-177 5..366 5..364
PpaGOX01 495 9e-177 1..366 1..364
PpaGOX03 491 2e-175 1..366 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 69813..69958 146 N° 2 70492..70616 125 N° 3 70941..70987 47 N° 4 71383..71460 78
N° 5 72033..72157 125 N° 6 72760..72826 67 N° 7 73216..73284 69 N° 8 73627..73696 70
N° 9 74229..74329 101 N° 10 74647..74751 105 N° 11 75251..75454 204  
join(69813..69958,70492..70616,70941..70987,71383..71460,72033..72157,72760..728 26,73216..73284,73627..73696,74229..74329,74647..74751,75251..75454)


exon

Literature and cross-references KflGOX02 (Kfl_002840030)
DNA ref. GenBank:   DF237233.1 (69813..75454)
Protein sequence: KflGOX02 (Kfl_002840030)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   378
PWM (Da):   %s   40741.46  
PI (pH):   %s   9.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDMDHITNVMELEPLAKQKLSKVVYDYYASGAEDENTLKLNRFAFEHYRLKPRVLVDISDQDLRTSILGHEISMPIMIAPTAMHKMAHHGELATARAAAATGTAVLSAHATSSIEEVASTGPGLRFFQLYVYRNRALVAQLVKRAERAGYTAIVLTADAPRLGKREADVKNRFQMPAGMTLKNFEDLGAVSSEASTNPALASLYLASQFDPSLQWKDVRWLQSVTSLPILVKGVMTAADAKLAISHGAKGIIVSNHGGRQLDHTQATIQALEVVLAADGRVPVFLDGGVRRGTDVLKALALGAKAVLVGRPVLYGLASGGQAGVEKVLTMLKDELELAMALVGCPSIKDIKRSCIVTPTDRLREAMPSSKLARL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACATGGACCACATCACCAATGTCATGGAGCTTGAGCCGCTGGCCAAACAGAAGCTCTCAAAGGTGGTTTATGATTACTATGCATCTGGAGCCGAGGACGAGAACACACTCAAGCTG
AACCGCTTTGCGTTTGAGCATTATCG
GTCAGCACAACACTTCGACAATTTGAAACGTCCTTGCAATAGTGTCAGCAGACCGTCTCTTCAACTGGCGGTTTGCTGATCACATCTGAAAATG
CATGCAATCTGGTGTTCATGACATACTGACACCGTGCTAGAAGTGTCTCGATACAGCATGACTCCCCTTAGGCTTTGTAGACAGCACAGAAAACCTTGATGTTTCTAAGAAGATCAGATA
AGTGAAACTTACCACCACCAATCAAGGTACATTGAACCTGGTGGACATGCCACGATGGGGCATGCACGAGTTTGCACTTAGGCACGAAAGACCGTGGTCAAGTTGCAACACTGGTACCTT
GAACTTCAGTACTATCTCGCTGTTCCTTACTTTGAAAGGGGGGGTTCAACCATCCAAAGGCTTTGAGAAGTTAATATTCCTCAAAGTCTGACTCAGCCTTTCTTCATTCGTTGGCCATCC
TCCTCGGCCATCTGATTGATCCTCTCCCTTTCCAGCTTTCCTGTCTTGTTTCTGCTCACCCCAGCGTCTTTTCTTACAGTCTGAAGCCCAGGGTCCTAGTGGACATTAGTGACCAAGACC
TGAGGACCAGCATACTGGGCCACGAAATATCCATGCCCATAATGATAGCCCCCACAGCTATGCACAAGATGGCTCACCATGAAG
GTATCAGTCACCGGCAACTCCGTCTCATGCTTCTCT
TTCAACAATCAGGTCTAGTAGACTGTCTGGGAATATTCTTCAGTGGCTGTGGTATTGCTGTACTCTTTTGATTCACAGCTCCTTTGAAGGTTCTTTGTGCTTAAGCTTTCCTTTAACCGA
CCCAGCCGCTCTTGTGAAACAAATTCTTGAGTACCTTAGAGGAGAGGGCACAGGTCCATCACTTGACTCAAAGCTAACTTCAACTCCTGTGATGCACAACCATTCGAATCGGACAACAGT
CAAACGGCGGTCCAGGCGCATGAAAACCTTTCTTCGTTCCCTCTGCAGGTGAGCTGGCGACTGCGCGGGCGGCGGCGGCAACGGGCACAGCCATGGTGAAGCACCGCTTCAAAGTTTTTC
CTGCTTCTTTCGTGAAAAGCCGCTCAAGTATTCATGCTCGTTTTCAAGCCAAGAATAACCCAGCCGTTCTCTCCTTGACAAACTCGTAAACCTCATCTGTCACGACGAAGTCCTTGGCTT
GTCACAAAGTTTCATCAACGCACAATGAATTGGGCATTGGCAAGTCCCCACTTTGACCCCCGCTCAACCATCTCTCTTTGAAAGAGGTGGCTGAGTCTATCTCTACTTGTGCGTGTGCAC
CGATGTAAGCAGATCTCAAAGAGTAGTACAGCCACCTAGCCAGCCCCCATTCCGACCCTCATATCCTCTTTCCCTACAAGGTCACTATCAGCATACCCACTTACCCTTGTGCTTCTCTTC
TTCAGCACAGGTGCTGTCGGCCCATGCTACGTCGAGCATCGAGGAGGTCGCCTCGACCGGACCCGGCCTGCGCTTTTTCCAACTCTATGTAGGTCCTATAATTATCTTTCCTCTTTGTTT
TGTCTTTGCTTTCCATCAGTCGGGTATCTAGTCAGGGCAGGTTCGCCTGGTCATCACCCCTGGCCCCCTTGTTTTATGACAGTTACGCAATTCAAAACCATGGGTTCGAATACCATACGA
CCTTACGAAGTTTGATTTGAGGCCAGACTTTTTCAGCTGTATTCTGAGAGTTTAGTTCGAGAACATCATAAGGGGTCCTCTGGCGAAATTGAACCCCTGCGCCAGCTCGGAATCTTTGCT
TAGGAACAATGGATTTGCAGGAAAGCAATGACCGCAGCGTGGAGGATTTAAACAGAAGGCTTTTTGTTTCCGAGCTTAGCGTCTACAGCCCCCACATAGATACCGCTCAGCTTCCAGAAG
CTTCCTTTGGTTTCTGCTGGATTGCCCTCGATTTCGCAAAGATTCTTATCAGCGTGAATTCGATCGTACACAGAGTTGGACAAAACAACTCAGAAACGCTACCAGATCCTCGAAGCTTGC
AAACAATTTCTGGTGCGACTGGGATGTACTGGGAATCTTACATCCAAATTTGCCACACAGGTGTATAGAAACCGGGCACTCGTGGCGCAGCTAGTGAAGAGGGCTGAACGGGCCGGGTAC
ACAGCCATCGTCCTGACAGCTGACGCACCAAGGCTGGGTAAACGTGAAGCTGACGTCAAGAACAG
GTGAAACGGTCTCCGAGGCTATCCTTTAGTTTCAATGAGGCCGGAGTGAATAGTT
GCTGGTCAAATCCGTTGCAAGGTTGGAAGTTGGAGACTCCCGCACAGATTATGGCGTTTTTTGGTCAAGCTATCTTTTTCGCTTGCTTCGAAAGCGAGTCGTGCGTCGGGGGGAGATCAA
AGATCGCTACAAACGGGGCGCCTGTCGGCGTTTTCGCGGCCTGGCTAGTTTGTGGCTACCCAGCCGCTGGGCATACACACACCCAGTGCACAAACTCAGCTGCAAGTGTGATCTTCGCAA
CCGAATCTATATCAGAAAAGCCGTCGAGAAACGCGTGCTCCTTGGTTGGCACTACAGAAACAACTGAGGTGTTTGTTGGCTAGCAATACAGAAGCAACTGAGGTGCTCGTTGGCTAGCAA
TACAGAAGCAACTGAGGTGTTCGTTGGCTAGCAATACAGGAACAACTGACGTGATTGGCTAGCAATACACAGTCAGTTGAGGTGTTTGGTATGCACGAGCCGTTATTTGAAAATGGTACT
GGGATAGCGTCTGTGCTCTTGGTAAAGATTGTGAAGCTTTTGGGCCCAACTGAATGCTTGCGCGCAGGTTCCAGATGCCCGCTGGCATGACTTTGAAGAACTTCGAGGACCTGGGCGCAG
TTTCTTCCGAAAAG
GTGAGGTTCTTGTGTCCACTTTCGTCCAAGACGTATGATTCTGCTTTGTGCAAATGGAGTAGTCCAGTCAATGGTAGGTCACGAGCATGCCTGTTTTGTCAGAGCC
GGAGGACGAATCCTAACGTGGGCTCTTGACAGCGACTGCAGTCTTAAACTCCAAAAGTTAAGAAGTGGCGGATTCGTCAAGCATCTCCAAGTACTCCAATGTCTTGCTCCGATTGGATCG
GTCGATTCGCACAGGTTGGAGCGGGCTCCCTCTTATAAAACCAAAGCCCACTCACTGACGAGGCACACCGTTGCTTCTTCATATCTACTGCAAGCTTTGCAATCATAAGCATCGCCTCCG
TTCTTAGTCCAGCCATTCAATGTGTGATCTTCGTTTCTTGCAGGCTTCCACCAATCCAGCCCTGGCCTCCCTCTACCTTGCTAGTCAATTTGACCCCTCTCTTCAGTGGAAGGTGCGCGG
CCCCTTGCTCCCGTTTTTAGCTTATTCTTGACGTTGTCCCAATAATTTTCCCGTACAAGAGGTTACTGGTAAGTGGAGCGTCTTTCTGTGGAACCAATCTCACATTTGACTTTGATCGGA
AACGAACAAACTGACGTTTGGCGACACTGTACTGCTTCGGTTTCACGTTTTACAGCAACGAGCCATCAAACTGCAACCTTGTCCAAGGAGGGCACGTCCCAAATAAGCTTTCGATGCTCG
ATAAGGGCCGTACTGAGGATAACGGATACTCCTTTGATAACCTTCCTTCTAGTTGCGACGATTGTAAAGTTCAACTTCGGGGCTTCCCGTGCAGGACGTTCGATGGCTCCAAAGCGTCAC
GTCGCTCCCCATCCTTGTCAAAGGCGTGATGACCGCAGCCGATG
GTGAGCCTTCTTTGTCGCCTGTTTGTTTTGGTATTTGTCCTCCCTCTCCCGAGTGAATTCGCTGGACATGTTCCTA
ACGTCAGGCCTTGCCTCATAAACATATCCTTTTCCTAGTGTGAGTCCTGCAAATCAGACTGCAGGAACCCATTTTTGAAGGCCATCAGCGCGGCATGTCGACACTTCCTCCCACATGAAA
TCCAAGCGTGATCTTGCTATCGTATCCTCTTCTAGTATATTGTCGCACACCATCGAGCTTCCCGTGAGCACGACCTTAACCCCAACCAAGGGTGCGCGTCGACCGAAAAGCGGCAAACAG
CTCTTCAGTATTCTTAGCCAATCGGATGGCTTGTCAGATCCACGTGGTAACCTAAGGTACACACCAGAATAGCATCATGGCCTGAAAATCACCGTACCTCTTACCAGTCGATACCGCAAA
GGCAACACTGGAGGTCAAGTAGGTTTTCGGTCGACGCAACCTCACTGACCCTAGAGACTGCGGCCCTCTGACGTAGTACTTCATCTGTGGGTCCAGCAAAGCTCGCTATCAGCCACGGAG
CTAAGGGCATTATTGTTTCGAACCACGGGGGCCGCCAGCTAGATCACACCCAGGCCACGATCCAAGCTCTCGAAGAG
GTGAGTTTCACGACTGACTCGACCTGGCGCAGCCTTTAGCGCG
GATTTCGCTGTAGTTTTGTACAAGCCGTGATAGCAGTGGTAGCAACTTTTAGGATCCGTTCAACAGGTTCGGTGACGCACGCGATCTGCAAGTTACTTCGCTGCGAAGGAGCTTGGGTGC
ATTTGTTTTGTCGCGGTATGACCCGGTGGGACTACGAAGTCGGGAAGTAAATCAAAAGTAACACGAGGAGCATTGAGAAACAGCAAGGAATCTAATAACCTAGAAGGAATGTTCAATGAC
TGAAGGAAGTCGGCTGAGCCGGTTGCTCTCGCAGGTAGTGCTTGCTGCGGACGGAAGAGTTCCGGTCTTCCTCGACGGAGGCGTCCGGAGGGGGACGGACGTCCTCAAAGCGCTTGCTCT
AGGAGCGAAGGCCGTTCTT
GTGAGTTTCTCGAATCTTCAGGCATCGATCTGTTCCGTTGTACGTCAACGTACGTCCGATCCCCTTTCGGCTAGTATAGCAGAAATAATGTTTTATGTTGC
TCCAATCAAGTTCTGATCGAGGGACCGGAGAAAAGGACATCTAAATCGGCTCACCCTTTCAACCATCAAATTTTTGTGTTGAGGACGCTCGAGACACCTAGATCGGTTGTCTCTGAGATT
ACGCAGGAGCACGCCTGTGATAGACACCTTCTTGTGTCTCTTCGCACCTGGAAATACTTCATAGCTTATGAAGGAAATTCATGTCTGCTGGGAGGCTGTAACCTCGCACCGTTCCCTCTT
TCTCATCGCCCTTCAGCCATGATCGGTGTGTTGCGTGCGCATGGTCTCCAAAACAGACCCATTCCCCGTACCGTACAACGGTCGGATTGTGCAACGACACCATGGTCTGGCATGCAGTGC
CACGTGGCCGCAGCTGAACAGCTTGTCGTTTCGCACAGGTTGGTCGGCCGGTGCTTTACGGTCTCGCCTCCGGTGGGCAAGCCGGCGTAGAGAAAGTGCTCACTATGCTGAAAGACGAGC
TTGAACTGGCAATGGCACTCGTCGGCTGTCCGTCCATCAAGGATATCAAGCGCTCGTGTATAGTTACACCGACGGACCGGTTGAGGGAAGCGATGCCGTCAAGTAAGCTTGCACGCTTGT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACATGGACCACATCACCAATGTCATGGAGCTTGAGCCGCTGGCCAAACAGAAGCTCTCAAAGGTGGTTTATGATTACTATGCATCTGGAGCCGAGGACGAGAACACACTCAAGCTG
AACCGCTTTGCGTTTGAGCATTATCG
TCTGAAGCCCAGGGTCCTAGTGGACATTAGTGACCAAGACCTGAGGACCAGCATACTGGGCCACGAAATATCCATGCCCATAATGATAGCCCCC
ACAGCTATGCACAAGATGGCTCACCATGAAG
GTGAGCTGGCGACTGCGCGGGCGGCGGCGGCAACGGGCACAGCCATGGTGCTGTCGGCCCATGCTACGTCGAGCATCGAGGAGGTCGCC
TCGACCGGACCCGGCCTGCGCTTTTTCCAACTCTAT
GTGTATAGAAACCGGGCACTCGTGGCGCAGCTAGTGAAGAGGGCTGAACGGGCCGGGTACACAGCCATCGTCCTGACAGCTGAC
GCACCAAGGCTGGGTAAACGTGAAGCTGACGTCAAGAACAG
GTTCCAGATGCCCGCTGGCATGACTTTGAAGAACTTCGAGGACCTGGGCGCAGTTTCTTCCGAAAAGGCTTCCACCAAT
CCAGCCCTGGCCTCCCTCTACCTTGCTAGTCAATTTGACCCCTCTCTTCAGTGGAAG
GACGTTCGATGGCTCCAAAGCGTCACGTCGCTCCCCATCCTTGTCAAAGGCGTGATGACCGCA
GCCGATG
CAAAGCTCGCTATCAGCCACGGAGCTAAGGGCATTATTGTTTCGAACCACGGGGGCCGCCAGCTAGATCACACCCAGGCCACGATCCAAGCTCTCGAAGAGGTAGTGCTTGCT
GCGGACGGAAGAGTTCCGGTCTTCCTCGACGGAGGCGTCCGGAGGGGGACGGACGTCCTCAAAGCGCTTGCTCTAGGAGCGAAGGCCGTTCTT
GTTGGTCGGCCGGTGCTTTACGGTCTC
GCCTCCGGTGGGCAAGCCGGCGTAGAGAAAGTGCTCACTATGCTGAAAGACGAGCTTGAACTGGCAATGGCACTCGTCGGCTGTCCGTCCATCAAGGATATCAAGCGCTCGTGTATAGTT
ACACCGACGGACCGGTTGAGGGAAGCGATGCCGTCAAGTAAGCTTGCACGCTTGTAA

Retrieve as FASTA