Entry information : PpaGOX04 (Pp3c4_29460)
Entry ID 13910
Creation 2016-10-14 (Christophe Dunand)
Last sequence changes 2016-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-14 (Christophe Dunand)
Peroxidase information: PpaGOX04 (Pp3c4_29460)
Name (synonym) PpaGOX04 (Pp3c4_29460)
Class Glycolate Oxidase    [Orthogroup: GOX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaGOX04
start..stop
S start..stop
BstrGOX03 532 0 3..372 1..369
AtGOX05 528 0 3..363 1..360
HaGOX09 525 0 3..363 1..360
BstrGOX04 523 0 3..363 1..360
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 292..434 143 N° 2 682..806 125 N° 3 976..1022 47 N° 4 1195..1272 78
N° 5 1553..1677 125 N° 6 1841..1910 70 N° 7 2071..2133 63 N° 8 2272..2341 70
N° 9 2694..2794 101 N° 10 3061..3165 105 N° 11 3298..3489 192  
join(292..434,682..806,976..1022,1195..1272,1553..1677,1841..1910,2071..2133,227 2..2341,2694..2794,3061..3165,3298..3489)


exon

Literature and cross-references PpaGOX04 (Pp3c4_29460)
Cluster/Prediction ref. Genebank:   5931647
Protein sequence: PpaGOX04 (Pp3c4_29460)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   373
PWM (Da):   %s   41100.66  
PI (pH):   %s   8.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLEVVNVDEYELLAKAKMSKMAFDYFARGSEDQVSLRENREAFSRIRLRPRILVDVSNIDVATSVMGFKISMPIMVAPTAHHKLAHPGELATARAASAADTLILSSSANCSMEEVAATGPGVRFFQLYVYKDRNITITLVRRAEQFGFKAIVLTVDTPRLGRREADIKNRFKLPSHLVYKNLEGLMNLEQMDSSHSELASWADSHFDRSLNWKDVEWLQSITHLPVLVKGILTAEDASLALQAGVKGIIVSNHGARQLDHVPATISVLEVVYAVRGRVPVFLDGGIRRGSDVFKALALGASGVFVGRPVPYALAVDGEAGATKVLQMLRDEFELTMALIGVRSVKEIRRQHVLTEQDSMKLALISKL*

Retrieve as FASTA  
Remarks (Chromo 4, 10 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTGGAGGTGGTCAATGTGGACGAGTATGAATTGTTGGCCAAGGCCAAGATGTCGAAGATGGCATTTGATTACTTTGCTCGCGGGAGCGAGGACCAAGTTTCCTTGAGAGAAAAT
CGGGAGGCATTCTCTCGAATAAG
GTGCGACAAGCAGATCACTTTTCTTCAATTCTAGGCGCCCTAATATGTAAGCAGAAAAGGGAGTGCGAATTCCCCACGGCTTGAATCAGAGTATCAA
TATTAGATGCAATCGAAAGACCGCTGTACATCGAGCATTTTCGCTAAATTGAGCGTCGATGTTCTTTTTCGGGTCATGGGAACCCTTCGTGCGCTAAGACTCTAATCGCATGTTTTATTT
GTTGCTACAATTTCCGATTCAATTATGCAGGCTGAGGCCTCGGATTCTAGTGGATGTGAGCAACATAGATGTGGCAACGTCAGTAATGGGATTCAAGATCTCCATGCCTATAATGGTAGC
CCCAACCGCGCATCACAAATTGGCACATCCTGAAG
GTACACCTTGACATACTTCGCCACACTAAGAACCGTGTTAGGGTTGTAGCAGGAATCTGATGCTTTAGCACCGACATACTACTGC
GTGTGGAGAGTGCTAAGAGCATGAGTTCCAGCATTATTCACAGCGTAGAATTTACAGAATTTGGTGCATTTGTTTGTGTTGCAGGAGAGCTTGCAACCGCAAGAGCTGCTTCAGCAGCTG
ATACTCTTATG
GTCTTCCTCACAACCTCTTGAGATAATGAGAAGTTTCCTTCGGTTACTTCTTTAGTCTCTGAAGCTAGAAAATTTGAGATACTTGTTGAGGAATGATTAGATCATCAGT
AGGCTACCACGAGCCATGATGCTAACAAAATTGCGGACTCTTGACGGATTTTGGTTTGCTCAGATTCTATCTTCTAGTGCTAATTGCAGCATGGAAGAAGTAGCTGCGACAGGCCCAGGA
GTCCGATTTTTCCAACTTTAT
GTGAGTGGATGTTTACTTGATCACTTGTAGGCAGAGGTTGACATTTCGATATGGCTTACGTTGCGAAGGATTTGAAAATTAAAGCAGTAATTAACGCAG
TTTTACTTCCTTCCACCCGTTTCGTTTCTGTTGATATTATGCTCGGATTTTGATTACATGTAGCGATTTAGGGTAACCTTCGAACCCATTTAGATTTTAGGCATTTGCAAGCACTACCCC
TTTTCTGCCTGTATTGCATGGTTTCGGTATTAAATTGAGCTTGTGCCGTTTTGTATGAAAGGTGTATAAGGATAGGAACATCACCATAACTTTGGTGCGGAGGGCAGAGCAGTTTGGCTT
CAAAGCCATAGTTCTCACCGTTGATACTCCACGGCTGGGCCGCAGGGAAGCAGACATAAAAAATAG
GTGAGTAATTCAGGGTCAAGTTAACCACAATGCCTACCTAAAACACCAAAAAGC
CAAGGAGAACACATGAAACCATGGGCTTGAAACATGGTGCAATGGAATGCTCTCAAGTAATGGAAAATTTTCGCTCCACGTTTGGAGGTCTTATTCTAGCTTGCTGCAGGTTCAAATTGC
CTTCCCACTTGGTATATAAGAATTTGGAAGGCCTCATGAATCTAGAGCAGATGGACAAG
GTACATCCCAATCCACCTCCGGAGGTCTTTGTCTTTTTATTAATTCTGATTCATGACTTGA
TTATAGTTAGTCCATCTCCGAGCCCACACTCGTAACTGAAAAGTTCGGAGAAGGCCAAAGTCGTTACGACCTGAATTCGAATTTTTGTTTGTGTCTCAGTCAAGTCATTCCGAGCTGGCT
TCTTGGGCAGACAGTCATTTTGACAGGTCTCTCAACTGGAAG
GTATAAGCTGCCAACCCTGCTCCTCTTGAAATGATGTGTTTCAGGCTGCTAAAGACCAGACTGCGCACTTTGTTAGGG
CTCTACGATCAAACTTGACACGAGTCATGTTCTTAGTATCTGGTGAATTTTTCATTGCAGGACGTGGAGTGGTTGCAAAGCATTACGCATCTGCCTGTGCTTGTGAAGGGTATTCTGACT
GCTGAAGATG
GTGAGAACAGAGTTACTCTCACTTATAAGTTTCTACAACGCTGTGTCGCTGCGATGATTTTGTGGCAAGGAGCTGAGCATTGAGATTTACAAAAATTATTCTTTAGTGAC
TTAGGGCGTGGAGCTTTTCTTCAACCATTTCCCTTACATACTTGTGGATGCAGACGAAATTATTGTGACTCGAGAGTATGTCAATGAATGGTGTAGTTGATTGTCAGGGCACAGCTTGTA
AATTATGATGCTTGCCTGTTTCACTTTTGTGTGGCTTAAGTACTTATATATAAAGCGTTGCTTTATTCATGTGAAAGTTGAGATGCCATGTCATGACTGACTTGAAAACTTTTCGTGTGT
AGCGAGTTTGGCACTACAAGCTGGAGTTAAAGGTATTATAGTATCCAACCATGGGGCTCGACAACTTGACCATGTACCGGCCACAATATCTGTTCTTGAAGAGGTTGTTCAACTCTTCTT
CTGCCTAATCTGAAAGACTTTTCCTGTATCCAAGAATCCCCAGTCTCTCGAAATGCATACATGATCATCCTGTGTTGTCAATTTCCAATATTTTTCTCCGCAAACGACTTGAACCTATTG
GAGTTCCCAGAGTGTCCGCATTCTATTCGCCTTGGGGAATGTGGAACATTGTGGATTACAACTGTAAGCTCTTCGAGGACCCGGCAGAGTTCAGTCTTGGTTGTTGGTAATTGTGGCTCG
GGAAAGCAGGTTGTGTACGCAGTCAGAGGGCGGGTCCCAGTGTTCTTGGATGGAGGCATCCGTCGTGGCTCAGACGTTTTCAAAGCTCTAGCACTCGGTGCATCCGGTGTTTTTGTAAGC
CGCTGATGCACAACCTTTGAATAATGCAGCGGAGTGGAATGTTGCAAAACACAGTACCCCACAGGGACTAACAGTAACGAGTTCGAATTTGTCTACCGACACCCCACATTCGCCTTTCTG
ATGCAGGTTGGAAGGCCCGTTCCATATGCGCTAGCTGTGGATGGCGAGGCTGGCGCGACGAAGGTGCTACAGATGCTGCGGGATGAGTTTGAGCTCACAATGGCACTCATTGGCGTTCGC
TCGGTGAAGGAGATACGTCGCCAGCATGTCCTCACGGAGCAGGATTCCATGAAGCTGGCCCTCATTTCAAAGCTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTGGAGGTGGTCAATGTGGACGAGTATGAATTGTTGGCCAAGGCCAAGATGTCGAAGATGGCATTTGATTACTTTGCTCGCGGGAGCGAGGACCAAGTTTCCTTGAGAGAAAAT
CGGGAGGCATTCTCTCGAATAAG
GCTGAGGCCTCGGATTCTAGTGGATGTGAGCAACATAGATGTGGCAACGTCAGTAATGGGATTCAAGATCTCCATGCCTATAATGGTAGCCCCAACC
GCGCATCACAAATTGGCACATCCTGAAG
GAGAGCTTGCAACCGCAAGAGCTGCTTCAGCAGCTGATACTCTTATGATTCTATCTTCTAGTGCTAATTGCAGCATGGAAGAAGTAGCTGCG
ACAGGCCCAGGAGTCCGATTTTTCCAACTTTAT
GTGTATAAGGATAGGAACATCACCATAACTTTGGTGCGGAGGGCAGAGCAGTTTGGCTTCAAAGCCATAGTTCTCACCGTTGATACT
CCACGGCTGGGCCGCAGGGAAGCAGACATAAAAAATAG
GTTCAAATTGCCTTCCCACTTGGTATATAAGAATTTGGAAGGCCTCATGAATCTAGAGCAGATGGACAAGTCAAGTCATTCC
GAGCTGGCTTCTTGGGCAGACAGTCATTTTGACAGGTCTCTCAACTGGAAG
GACGTGGAGTGGTTGCAAAGCATTACGCATCTGCCTGTGCTTGTGAAGGGTATTCTGACTGCTGAAGAT
G
CGAGTTTGGCACTACAAGCTGGAGTTAAAGGTATTATAGTATCCAACCATGGGGCTCGACAACTTGACCATGTACCGGCCACAATATCTGTTCTTGAAGAGGTTGTGTACGCAGTCAGA
GGGCGGGTCCCAGTGTTCTTGGATGGAGGCATCCGTCGTGGCTCAGACGTTTTCAAAGCTCTAGCACTCGGTGCATCCGGTGTTTTT
GTTGGAAGGCCCGTTCCATATGCGCTAGCTGTG
GATGGCGAGGCTGGCGCGACGAAGGTGCTACAGATGCTGCGGGATGAGTTTGAGCTCACAATGGCACTCATTGGCGTTCGCTCGGTGAAGGAGATACGTCGCCAGCATGTCCTCACGGAG
CAGGATTCCATGAAGCTGGCCCTCATTTCAAAGCTTTGA

Retrieve as FASTA