Entry information : PpaMDAR01 (Pp3c15_710)
Entry ID 13922
Creation 2016-10-18 (Christophe Dunand)
Last sequence changes 2016-10-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-18 (Christophe Dunand)
Peroxidase information: PpaMDAR01 (Pp3c15_710)
Name (synonym) PpaMDAR01 (Pp3c15_710)
Class Monodhydroascorbate Reductase    [Orthogroup: MDAR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaMDAR01
start..stop
S start..stop
PpaMDAR02 754 0 1..433 22..455
PpaMDAR03 624 0 22..433 22..434
HaMDAR03 603 0 7..433 8..435
ThasMDAR02 572 0 7..433 8..435
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 453443..453493 51 N° 2 453132..453203 72 N° 3 452753..452804 52 N° 4 452237..452317 81
N° 5 451996..452114 119 N° 6 451588..451807 220 N° 7 451286..451404 119 N° 8 450922..451047 126
N° 9 450327..450467 141 N° 10 449869..450189 321  
complement(join(449869..450189,450327..450467,450922..451047,451286..451404,4515 88..451807,451996..452114,452237..452317,452753..452804,453132..453203,453443..4 53493))


exon

Literature and cross-references PpaMDAR01 (Pp3c15_710)
DNA ref. GenBank:   NW_001865467.1 (453493..449869)
Cluster/Prediction ref. Genebank:   5939996
Protein sequence: PpaMDAR01 (Pp3c15_710)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   434
PWM (Da):   %s   46907.92  
PI (pH):   %s   5.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATIDRKYIVVGGGVAGGYAAREFVKLGLQPGELTIFSKEAAAPYERPALSKAYMFPEAAARLPGFHVCVGSGGERQLPDWYAEKGIELKLESEIVKADLENKTLTTDKGDVYSYGTLVIATGSFLNLADFKTAGADAKGIYYLREVHEADKLVDAIKANKGGEAVVVGGGYIGLELAACLTINKIKVTMVFPDPCFMPRLFTPELASFYEGYYENKGVNIIKGTSVTAFEKDDNGHVSKVILKDGRTLDSTLVVVGVGAKPLLGPFKGLLEEEKGGIVDASFKTSDPNVYAVGDIATFPMKMYGDTRRVEHVDHARKSAMQAVQAIKAAEKGEVVDEYDYLPFFYSRSFDLSWQFYGDNVGETVHWGREAGTPDSKFGAYWVKDNRVMGAFLEGGSPDENKLIAKVAREQPSVNSTQDLVSAGLGFASKV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 15, 9 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACAATTGATCGCAAATACATTGTGGTGGGAGGAGGTGTAGCCGGGGTAAGGTTTGAGATGTTTTTCATAGGGTTGCTAGTGTGGCATTGAAATGATCTATTTGGATTGCATCGA
GGCTGGTACTGTGGTGCAGTGTTGAGCAAGTTCTAGATGATTGCACAAGAGGTTCACTGCCACAGAGGATATATGAACACTGCATCAAATTCATGATTAAAAACCGGTAGGATTTTTAAC
TTACAGTGTGTGAAGTGCAGAAACTGAGACGGTGTTTGCAATGTGTGCAGGGCTACGCTGCACGAGAGTTTGTCAAATTGGGCTTGCAACCTGGAGAATTGACCATTTTCTCCAAAGAAG
CG
GTAAATTGCTTCTGCCTTAATGATCGTAACTTATTAACGGTGGTTGTTTTGGTTTATTATGTCAAAGACTTACTTGGTTAAGACAAATATTATTTCTCTAGTTGTTGTTTGGTATATA
TCTATGAATATTTTTTTCTTGTTAGCCTCATGCTAGGACGATCGATTCAAGTAGTATAAGTGCGGAATGTTCGATTCTCCATATTTCAGACAAGGCTTTCTGATTTCTCCGCAAGAATGT
CGCGTCTTTGAGTCAGATGAGGTGTTGCTTTGCAGTGTAGAGCACAGAAAATTGTCGAGTGACTGACTTGATTAAAATCGGAATGTCAGGCGGCACCTTATGAGCGACCCGCCTTGAGCA
AAGCTTACATGTTCCCTGAGG
GTAAGTTTTCAGAACATCAATTCTGTTCTCGCATATTCTCCAGATATGCGGACGCATCTGGATCTGAGCAGTTTCGCATCTTTCAAGTCTTACTCACTG
TTCTATAGACTTTGCCTCGCTCTAGAAAAGCATCTTAAACCACACTGTAGTATTTTAGGTTGACTGTTGGATAATATATGAGCTACTGCAGTACTGCTTTCCACTACTGTCTCTAACTAG
TGTTCGCAGGAATTTGGTTGGTCAGTACAATGTGTCCATGTCTCCTCATACCATCTGTGGGGGTATTTGTTTCAGCGGCAAGTGATGAGCTGCTGTGTGAACAGCACCTCAATATACGGA
GTTGAAGTAGCAATTATGTTTTTAAACACGATCTTACTTTATTTTTTTAATGAGGTGATGGATTGGTTGATTTATTTATTTGTTCTTCTGTGACAGCTGCTGCTAGGCTTCCAGGCTTCC
ATGTCTGTGTAGGAAGCGGTGGAGAGAGACAGTTACCGGACTGGTATGCCGAAAAAG
GTATACTTTTCCAACCGTACACTGTGATTGTGAAGTTCATCATTATTGTTTGCCACGATGCAG
GAAAGCTTGAACCCTACTGGTAGTTTTTAACACGAAGTAACATGCATTTCGACTGTCAGGTATTGAACTGAAACTGGAGTCTGAGATTGTGAAGGCCGACCTAGAGAACAAGACTCTGAC
GACAGATAAGGGAGATGTCTACAGTTATGGAACTCTGGTTATTGCCACAGGCTCTACG
GTGGGTGTGCTGCTGTTTCTTATCGTAAAAAGCTTTACGCTGAAGTAGATTTTGTATTAAAG
CTTTTTTATCGCCTTAAGTTTCTGTTATTTAATAGCATTGCCTACTTTTGTAGAGTAAAGAGTTTGACGACGAAACTAGTGTCTAATTTGAATAATCAAAGCTCTAAGTAATAACTTTTC
TTGCAGTTCCTTAACCTTGCTGACTTCAAAACTGCTGGAGCCGACGCTAAAGGTATTTACTACCTGAGAGAGGTGCATGAAGCTGATAAGCTTGTTGACGCCATTAAAGCCAACAAGGGA
GGTGAAGCAGTGGTTGTCGGTGGAGGTTACATTGGGCTGGAATTAGCTGCATGCCTGACAATCAATAAGATTAAAGTCACAATGGTGTTCCCAGACCCATGCTTCA
GTAAGAGTTTTACC
ATACCTGGTCAATAGGTCGTATGCGATGGGCTCTATGTATGAAGTGAACGTTTCGAAGAAACCAGTTCTCCCGCAGACTGGAATGCGTGGGAATGATGATGAAATCCGTAATAAGAAGGT
TTACGCACAATATCTGCTAAATTTTTCCGGCCTTGTAATTTGATTGCAGTGCCTCGTTTGTTTACACCCGAGCTTGCCTCCTTCTATGAGGGTTATTACGAGAATAAGGGTGTGAACATC
ATCAAGGGAACGTCTGTGACTGCTTTTGAGAAAGATGATAATGGCCAT
GTAAGATCCTGATCCTTGAAGCTGCAAATGATAGTTATCGGTGTTAGGAAAGCTTAGAAAGTAGGAGTGACG
TAATATTTCTGTTAGGATCTGTAACCTCAGTACACCATGGGCCACAACACATTGCATTGGCAGATCTTACGTAGATGCACTAACATAGTGGTTTGGATAGTGCAGCTTCATTCTCTGGTT
TTCCCTTGATTCTATATGTTTTGATATATTAGAACGGCTGATGCAGGTATCGAAAGTAATTCTGAAAGATGGAAGAACGTTGGACAGCACTCTCGTGGTTGTGGGAGTTGGTGCAAAACC
ACTTTTGGGTCCTTTTAAGGGTTTGTTGGAGGAGGAGAAGGGTGGTATTAAG
GTTTGTGTTTTCTGCTCTATAACGTAATAAGTGGTTGATATACACGCTAATGTTTATTCATTGGCGCA
ATTTCTGTTGTGCTGGTTTATCTTGTTACCTAGCCAGTAGATGAATCAGGTGGGATGCCAAGAAAGTGAGAATGGTAACTGTCTTGTTAGCATGAAGAGGATTTGTGAATCTATATAGAG
AAAATCATTCTTAGAAATAAATCACAATTTCATCTGAAAATTATGCATGGTGAAAATAAGATCGTCGTAGATGGTTTGATAATATCGAAACTATTCGAATTCTTATTCAAAGATAAACTT
CGGCAAACAAGTAAATAGCCTTAGTTCTGAGTGTAAAACCCTGTCTCTATGGCACAGAAAGTGGGAATAGAAGGCACTCTTTCCAACGATTCTTTGTTTGTGAATTTTTTTGAAAGCCTA
CTTACTTTTGAATGATTGTTTTTCAGGTTGATGCCTCATTCAAGACAAGTGACCCCAACGTGTACGCTGTAGGTGATATTGCGACGTTCCCAATGAAGATGTACGGCGACACTCGGCGAG
TGGAGCATGTGGATCATGCAAGGAAGTCGGCCATGCAGGCTGTGCAG
GTATGTAGTGCTCTATGCTTATATCTGAATTGAATCAGTAAATCACTACGTGCCTTCTTTATGACACCTTGGG
TATGCTTTGCACTTAATTTACTGGAAAGTCCTAATACATTGTTCTGCAAACTGATTGTGAACAGGCTATCAAAGCTGCAGAGAAGGGCGAAGTCGTGGACGAGTACGATTACCTGCCTTT
CTTCTACTCTCGCTCCTTCGATCTGTCGTGGCAGTTTTATGGCGACAATGTGGGTGAAACTGTGCATTGGGGCCGAGAGGCTGGAACACCTGACTCAAAGTTTGGTGCTTACTGGGTTAA
GGACAACAGGGTAATGGGCGCCTTTTTGGAGGGTGGTTCACCTGATGAAAACAAGTTAATTGCCAAAGTTGCCCGAGAACAACCGTCTGTGAATTCTACACAGGATTTAGTATCTGCTGG
ATTAGGCTTCGCATCCAAGGTATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACAATTGATCGCAAATACATTGTGGTGGGAGGAGGTGTAGCCGGGGGCTACGCTGCACGAGAGTTTGTCAAATTGGGCTTGCAACCTGGAGAATTGACCATTTTCTCCAAAGAA
GCG
GCGGCACCTTATGAGCGACCCGCCTTGAGCAAAGCTTACATGTTCCCTGAGGCTGCTGCTAGGCTTCCAGGCTTCCATGTCTGTGTAGGAAGCGGTGGAGAGAGACAGTTACCGGAC
TGGTATGCCGAAAAAG
GTATTGAACTGAAACTGGAGTCTGAGATTGTGAAGGCCGACCTAGAGAACAAGACTCTGACGACAGATAAGGGAGATGTCTACAGTTATGGAACTCTGGTTATT
GCCACAGGCTCTACG
TTCCTTAACCTTGCTGACTTCAAAACTGCTGGAGCCGACGCTAAAGGTATTTACTACCTGAGAGAGGTGCATGAAGCTGATAAGCTTGTTGACGCCATTAAAGCC
AACAAGGGAGGTGAAGCAGTGGTTGTCGGTGGAGGTTACATTGGGCTGGAATTAGCTGCATGCCTGACAATCAATAAGATTAAAGTCACAATGGTGTTCCCAGACCCATGCTTCA
TGCCT
CGTTTGTTTACACCCGAGCTTGCCTCCTTCTATGAGGGTTATTACGAGAATAAGGGTGTGAACATCATCAAGGGAACGTCTGTGACTGCTTTTGAGAAAGATGATAATGGCCAT
GTATCG
AAAGTAATTCTGAAAGATGGAAGAACGTTGGACAGCACTCTCGTGGTTGTGGGAGTTGGTGCAAAACCACTTTTGGGTCCTTTTAAGGGTTTGTTGGAGGAGGAGAAGGGTGGTATTAAG
GTTGATGCCTCATTCAAGACAAGTGACCCCAACGTGTACGCTGTAGGTGATATTGCGACGTTCCCAATGAAGATGTACGGCGACACTCGGCGAGTGGAGCATGTGGATCATGCAAGGAAG
TCGGCCATGCAGGCTGTGCAG
GCTATCAAAGCTGCAGAGAAGGGCGAAGTCGTGGACGAGTACGATTACCTGCCTTTCTTCTACTCTCGCTCCTTCGATCTGTCGTGGCAGTTTTATGGC
GACAATGTGGGTGAAACTGTGCATTGGGGCCGAGAGGCTGGAACACCTGACTCAAAGTTTGGTGCTTACTGGGTTAAGGACAACAGGGTAATGGGCGCCTTTTTGGAGGGTGGTTCACCT
GATGAAAACAAGTTAATTGCCAAAGTTGCCCGAGAACAACCGTCTGTGAATTCTACACAGGATTTAGTATCTGCTGGATTAGGCTTCGCATCCAAGGTATAA

Retrieve as FASTA