Entry information : Kfl4CxxC01 (KFL_000080310)
Entry ID 13991
Creation 2016-10-25 (Christophe Dunand)
Last sequence changes 2016-10-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-25 (Christophe Dunand)
Peroxidase information: Kfl4CxxC01 (KFL_000080310)
Name (synonym) Kfl4CxxC01 (KFL_000080310)
Class 4CxxC Grx    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Kfl4CxxC01
start..stop
S start..stop
Ppa4CxxC01 172 5e-50 609..770 28..187
Cbra4CxxC02 176 1e-49 619..771 189..337
Mp4CxxC01 177 2e-47 610..770 464..622
Ppa4CxxC04 177 2e-47 610..770 459..617
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 287951..290052 2102 N° 2 287347..287560 214  
complement(join(287347..287560,287951..290052))


exon

Literature and cross-references Kfl4CxxC01 (KFL_000080310)
Protein sequence: Kfl4CxxC01 (KFL_000080310)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   771
PWM (Da):   %s   82965.58  
PI (pH):   %s   8.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSGESERSFKGASAKSPSRQTPAFLQRLDTAPVIGSRTPPRVPEGGQKMRRSSLQVSKSTGNLAELEYLSPSVLVSPATLRRRLTLPVPAAALTVPEEGKMHSGRRALSINGSIDSEVTERPLFVKKVKKDALSGELSGAALGLKRIRVREDASHAREDIGARAAAETDPGRSLRLQASRGGENNATRVVEKRNLWGTTWVEKSDLWKTSWLAEREKRKTTRDGERDPRGTPPARSPESGGRSPDLVIEKIAWPVEERRSPPRLIERVASMGGRPIPKPLEIPPVEDLSSEPEAEVVKQEEHDKAPSNGGEREEKKPEGGQKDVGLQASEEELGLPGVEKEAALTGGKKEVGLQAGVDEPALSRTEREEAPAEQKQGSLLVENMTLDELAALRRISGEVIDQVSARARRRGISDVDFSAEANAFGSPISNVGPLFDPDMLASFEEDLHNLTEEEWQARKSEDRVSFSFARGLAAVVGNRGGAAETSQAGGDVEKKSSGGVSRTASMGNGGLEEVMSEVESFLSRLELDANSSSQQAPTKVLTPTGAEKQRAPDGGVVLQLLEMAEAKPPRSPNRSPIPSPKGSPRPSLSLGKPPLSPKKSPRNGFPPLPNPAARSPRGAPPRGLDRVVVYTTSVRAVRKTFEECNAVRGVFLGHGVAIDERDISMHGEFREELRALMGGLVAVPRVFIRGKYIGGAEDIQRLNDCRELLPLLDGFERRRSQDSCGSCGGVRFHLCRTCNGSCKVVSGANPDDVVRCPDCNENGLKMCGVCA

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGGAGAGAGTGAGAGAAGTTTCAAGGGGGCCAGCGCCAAGAGTCCATCGAGGCAGACTCCAGCGTTTCTCCAACGGCTGGACACAGCGCCTGTGATTGGATCCCGGACCCCGCCA
CGGGTTCCAGAGGGCGGGCAGAAAATGCGCCGCTCCTCGTTGCAGGTCAGCAAGAGCACAGGGAATCTCGCCGAGCTTGAATATTTATCCCCGTCGGTGCTGGTCTCGCCAGCAACTCTT
AGACGGCGGTTGACTTTGCCAGTGCCGGCAGCGGCCCTCACAGTCCCAGAAGAGGGGAAGATGCATTCCGGGAGGAGAGCGCTGTCGATCAATGGGTCCATCGATTCGGAGGTGACGGAA
CGGCCATTGTTTGTGAAGAAGGTCAAAAAGGACGCGTTATCTGGGGAGCTTTCGGGGGCGGCCCTTGGCCTGAAGAGGATCCGGGTGCGGGAAGATGCGAGCCATGCGCGGGAGGACATC
GGCGCTCGCGCGGCGGCAGAAACTGACCCTGGGAGGAGTCTGAGGTTGCAGGCGAGCAGGGGTGGGGAGAACAATGCAACTAGGGTTGTGGAGAAAAGGAACCTCTGGGGTACGACTTGG
GTGGAAAAGAGTGACCTTTGGAAGACGAGCTGGCTGGCAGAGAGGGAGAAGCGGAAGACAACTAGGGACGGGGAGAGGGATCCCCGCGGGACTCCACCTGCGAGAAGTCCAGAGTCAGGG
GGGCGGTCGCCGGACTTGGTGATTGAGAAGATTGCCTGGCCCGTAGAGGAGAGGAGGTCTCCGCCGCGATTGATCGAGAGAGTGGCTTCAATGGGGGGGCGGCCGATACCAAAGCCGCTA
GAGATTCCGCCTGTTGAGGATCTGAGCAGCGAGCCGGAAGCAGAGGTGGTTAAGCAGGAGGAGCATGACAAAGCGCCCAGCAATGGGGGGGAAAGAGAGGAGAAAAAGCCAGAGGGTGGC
CAGAAAGACGTCGGTCTGCAGGCGAGCGAGGAGGAATTAGGCTTGCCGGGGGTGGAGAAAGAAGCGGCTCTGACGGGCGGAAAGAAAGAAGTAGGGTTGCAGGCAGGGGTCGATGAACCC
GCGCTGTCCAGAACGGAGAGGGAAGAGGCGCCGGCAGAGCAAAAGCAAGGTTCGCTGCTGGTGGAGAACATGACCTTGGATGAGCTGGCGGCGCTGCGGCGCATCTCGGGCGAGGTCATC
GACCAGGTCAGCGCGCGGGCGCGGCGGCGGGGCATTTCGGACGTCGACTTTAGCGCCGAGGCAAACGCGTTCGGGAGCCCCATCTCCAACGTGGGGCCGCTGTTCGACCCCGACATGCTG
GCGTCGTTCGAGGAGGATCTGCACAACCTGACCGAGGAAGAGTGGCAGGCGCGCAAGTCGGAGGACCGGGTCTCGTTCAGTTTCGCACGGGGACTGGCGGCAGTGGTCGGCAACCGGGGG
GGTGCGGCAGAGACCTCCCAGGCGGGGGGCGACGTAGAGAAGAAATCAAGTGGGGGAGTAAGCCGGACGGCTAGTATGGGCAATGGGGGCTTGGAGGAGGTGATGAGCGAGGTCGAGAGC
TTTTTGTCACGGTTGGAGCTGGATGCAAACAGCTCTTCGCAGCAGGCGCCGACCAAGGTCCTGACTCCGACGGGGGCGGAAAAGCAGAGGGCGCCAGACGGCGGCGTCGTGTTGCAGTTG
TTAGAGATGGCCGAGGCCAAGCCCCCCCGCTCGCCAAACCGCTCGCCGATCCCCTCGCCAAAGGGATCCCCCCGGCCAAGTCTCTCCCTCGGGAAGCCCCCCCTCTCTCCTAAGAAGAGC
CCCAGAAACGGCTTCCCCCCCTTACCGAATCCTGCGGCCCGCTCACCAAGAGGCGCGCCCCCCCGGGGGCTGGACAGGGTGGTTGTGTACACGACAAGTGTCAGGGCGGTCCGGAAGACG
TTTGAGGAGTGCAACGCGGTGAGGGGGGTGTTTTTGGGGCACGGGGTCGCGATCGACGAGCGGGACATCTCGATGCACGGGGAGTTCCGGGAGGAGCTGCGAGCGCTGATGGGGGGCTTG
GTTGCGGTGCCCCGGGTGTTCATTCGGGGGAAGTACATTGGAGGCGCTGAAGACATTCAGAG
GTGAGCGCCACTTTTATTGAAGTGTGCTTGTTGGCAGGGGCTGTTTGTATCTGGTTTA
GATGGTTTGGGTCAACATCCGGATGTGTGGGGTTGATGCAGTTTGACAGCGACCCAAGTGTTGTTGTCGCCGTGGGTTCAGGCAAAGCCCTCTCAGCATTCCTTTGTAGAGCTTGTCAAT
CGAAGGCTACCTTAGAACCACTTTCGGACTTTCTCGATCCGTATATGTAGCCGGGATTTTTGGGTGCGGGGTTTGGCTTTTTATGAATCGGAGAAAGGTCTCGTTGAATGAAGTGTCGCA
GAAGGATTGAGAAATCGTGCACATTTTTGTCGTCTCTGAGAGGTTGATGAAGAGGAAGAATAGGTTCTAATTCGCTGTGGTTTCTGTTGCAGGCTAAACGATTGCCGGGAGTTGCTTCCC
CTGTTGGACGGTTTTGAGCGGCGGAGAAGCCAGGACTCCTGTGGCAGCTGCGGGGGAGTGCGCTTCCACTTGTGCCGCACGTGCAACGGCAGCTGCAAGGTGGTGTCCGGAGCCAACCCG
GACGACGTGGTCCGGTGTCCGGACTGCAACGAGAACGGGCTGAAAATGTGCGGTGTGTGTGCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGGAGAGAGTGAGAGAAGTTTCAAGGGGGCCAGCGCCAAGAGTCCATCGAGGCAGACTCCAGCGTTTCTCCAACGGCTGGACACAGCGCCTGTGATTGGATCCCGGACCCCGCCA
CGGGTTCCAGAGGGCGGGCAGAAAATGCGCCGCTCCTCGTTGCAGGTCAGCAAGAGCACAGGGAATCTCGCCGAGCTTGAATATTTATCCCCGTCGGTGCTGGTCTCGCCAGCAACTCTT
AGACGGCGGTTGACTTTGCCAGTGCCGGCAGCGGCCCTCACAGTCCCAGAAGAGGGGAAGATGCATTCCGGGAGGAGAGCGCTGTCGATCAATGGGTCCATCGATTCGGAGGTGACGGAA
CGGCCATTGTTTGTGAAGAAGGTCAAAAAGGACGCGTTATCTGGGGAGCTTTCGGGGGCGGCCCTTGGCCTGAAGAGGATCCGGGTGCGGGAAGATGCGAGCCATGCGCGGGAGGACATC
GGCGCTCGCGCGGCGGCAGAAACTGACCCTGGGAGGAGTCTGAGGTTGCAGGCGAGCAGGGGTGGGGAGAACAATGCAACTAGGGTTGTGGAGAAAAGGAACCTCTGGGGTACGACTTGG
GTGGAAAAGAGTGACCTTTGGAAGACGAGCTGGCTGGCAGAGAGGGAGAAGCGGAAGACAACTAGGGACGGGGAGAGGGATCCCCGCGGGACTCCACCTGCGAGAAGTCCAGAGTCAGGG
GGGCGGTCGCCGGACTTGGTGATTGAGAAGATTGCCTGGCCCGTAGAGGAGAGGAGGTCTCCGCCGCGATTGATCGAGAGAGTGGCTTCAATGGGGGGGCGGCCGATACCAAAGCCGCTA
GAGATTCCGCCTGTTGAGGATCTGAGCAGCGAGCCGGAAGCAGAGGTGGTTAAGCAGGAGGAGCATGACAAAGCGCCCAGCAATGGGGGGGAAAGAGAGGAGAAAAAGCCAGAGGGTGGC
CAGAAAGACGTCGGTCTGCAGGCGAGCGAGGAGGAATTAGGCTTGCCGGGGGTGGAGAAAGAAGCGGCTCTGACGGGCGGAAAGAAAGAAGTAGGGTTGCAGGCAGGGGTCGATGAACCC
GCGCTGTCCAGAACGGAGAGGGAAGAGGCGCCGGCAGAGCAAAAGCAAGGTTCGCTGCTGGTGGAGAACATGACCTTGGATGAGCTGGCGGCGCTGCGGCGCATCTCGGGCGAGGTCATC
GACCAGGTCAGCGCGCGGGCGCGGCGGCGGGGCATTTCGGACGTCGACTTTAGCGCCGAGGCAAACGCGTTCGGGAGCCCCATCTCCAACGTGGGGCCGCTGTTCGACCCCGACATGCTG
GCGTCGTTCGAGGAGGATCTGCACAACCTGACCGAGGAAGAGTGGCAGGCGCGCAAGTCGGAGGACCGGGTCTCGTTCAGTTTCGCACGGGGACTGGCGGCAGTGGTCGGCAACCGGGGG
GGTGCGGCAGAGACCTCCCAGGCGGGGGGCGACGTAGAGAAGAAATCAAGTGGGGGAGTAAGCCGGACGGCTAGTATGGGCAATGGGGGCTTGGAGGAGGTGATGAGCGAGGTCGAGAGC
TTTTTGTCACGGTTGGAGCTGGATGCAAACAGCTCTTCGCAGCAGGCGCCGACCAAGGTCCTGACTCCGACGGGGGCGGAAAAGCAGAGGGCGCCAGACGGCGGCGTCGTGTTGCAGTTG
TTAGAGATGGCCGAGGCCAAGCCCCCCCGCTCGCCAAACCGCTCGCCGATCCCCTCGCCAAAGGGATCCCCCCGGCCAAGTCTCTCCCTCGGGAAGCCCCCCCTCTCTCCTAAGAAGAGC
CCCAGAAACGGCTTCCCCCCCTTACCGAATCCTGCGGCCCGCTCACCAAGAGGCGCGCCCCCCCGGGGGCTGGACAGGGTGGTTGTGTACACGACAAGTGTCAGGGCGGTCCGGAAGACG
TTTGAGGAGTGCAACGCGGTGAGGGGGGTGTTTTTGGGGCACGGGGTCGCGATCGACGAGCGGGACATCTCGATGCACGGGGAGTTCCGGGAGGAGCTGCGAGCGCTGATGGGGGGCTTG
GTTGCGGTGCCCCGGGTGTTCATTCGGGGGAAGTACATTGGAGGCGCTGAAGACATTCAGAG
GCTAAACGATTGCCGGGAGTTGCTTCCCCTGTTGGACGGTTTTGAGCGGCGGAGAAGC
CAGGACTCCTGTGGCAGCTGCGGGGGAGTGCGCTTCCACTTGTGCCGCACGTGCAACGGCAGCTGCAAGGTGGTGTCCGGAGCCAACCCGGACGACGTGGTCCGGTGTCCGGACTGCAAC
GAGAACGGGCTGAAAATGTGCGGTGTGTGTGCGTGA

Retrieve as FASTA