Entry information : Kfl4CxxC02 (Kfl_009920030)
Entry ID 13995
Creation 2016-10-25 (Christophe Dunand)
Last sequence changes 2016-10-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-25 (Christophe Dunand)
Peroxidase information: Kfl4CxxC02 (Kfl_009920030)
Name (synonym) Kfl4CxxC02 (Kfl_009920030)
Class 4CxxC Grx    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Kfl4CxxC02
start..stop
S start..stop
Mpal4CxxC01 177 3e-49 335..487 466..618
Ppa4CxxC05 163 8e-49 341..487 2..148
Ppa4CxxC04 176 1e-48 335..487 465..617
Mp4CxxC01 173 6e-48 335..487 470..622
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17874..17954 81 N° 2 16698..16844 147 N° 3 15283..16119 837 N° 4 14317..14502 186
N° 5 13238..13453 216  
complement(join(13238..13453,14317..14502,15283..16119,16698..16844,17874..17954 ))


exon

Literature and cross-references Kfl4CxxC02 (Kfl_009920030)
Protein sequence: Kfl4CxxC02 (Kfl_009920030)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   488 (471)
PWM (Da):   %s   53140.73 (51518.9) Transmb domain:   %s   i7-25o
PI (pH):   %s   6.74 (6.74) Peptide Signal:   %s   cut: 18 range:18-488
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSVSMSALGFAALALAAGVWVLGGRHAGNGREEKKVAPSVQIPSTIEVSDDEEDDLWEHIASILEARKRGSGHSKLSAEDDEEVWRIIEQIVAARARSHPAFQSPDKASTLSVKELRRWFESQAVERAGQSNSAKARGERGLRKPGELENEPLVEGKNGLHRQGENGVQGRGQNGHRESSYGEKISVKAVLSDEESPNSKREWAALKEAALLGNNFGRAGGEEGRDVKSKEDPLGERREVGTASTARKKSEAEAAEAAPKASKIVRRRKSIPSESDLNAMVANLDENGGQSEREKGEERKEDADERHSNGDQGKKVAVNGDTGLEQVSVSGGSEYRGPAGGEDRVVVYMTSVRAVRKTFEECATVRQIFHGFSIAVDERDISIHLPYRQEMRDLMGGRLVNVPQVFIRGKHIGGVQEVRFLADEKKMHELLVGMPRIKFTEECGGCGGGKFLPCVDCRGSRKIIVGDKVETCFACNEYGLIRCPMCA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTCTGTATCAATGAGTGCTTTAGGGTTTGCAGCACTAGCTCTGGCTGCTGGGGTATGGGTGCTTGGAGGACGGCATGTAAGTTTCCCGTATATCGCAAGATCAGATCTTTTTGGA
CTTGGCGTTCTTAGCATCTTTCCAGGCCGCCATAACTTTTTATTCAAAGGCCTCAGTCCACTCCGACAAATGCCTAACATGCTTGGAGCAAGGCTCATGTAGGCGCTCTTGTCAAGACCT
GGTTAGATGTTTTATGGAACCTCTTGGTATGGAGTCCAGTGGGTTTGCATCCGCGTTTTGGAGGGAAAGAAAACTCAGTGGCTTGATCCAAGAATGGGGCACGTGTGCGAAAGTATGCAG
CATGGCATGTTTGTGACAGCTAGTCAACTGTGCCGGAGGCTTTTGGTTTGAGAAGGAGCACCCATGCCAGTAACCACACTCAGGAAAGTAGCAATGGTGGTGTGGTCTGGTGAAGTTGAT
ACATCTTGAAGACAAAAAGAATATTCAAATCAGTTCTGGCAACCCCCGCCGTGCTGCTGACAGGATGCACACGCCAAATTGCTTGTGAGCTTTTCTGCTTTGGAACATTCCTAGCATTGA
AATCTTTTTCCAAGTGGTCCACAATGTGAGGTGCCCTTTGCCTGCTTCAGGTCACATCGCTAGAGATCTGCTTAAACCCCGATTGGTCTGCCAGAGTAGACCTGCAAAGCTGGAGGCAAT
TCTGGGCCTGAGAAGGCCACACAAAATCCAAGGATGGCAGCCGGCTGTCAACTTTGAACCGATGGAATCATGTGCAGTCGGTATTTCAGATTTCTGGGGCCTTTGTTTGCAAGTCTTGTG
TCAGAACAGAAGGCGAACAGGGACTCCTGGCGGTCTCTGTAGGACCCCCTTCCACAATAACCCGTTCGATTGACGGTCAGAAACAGTGAATCTAATGAGCCCAGACCGTCGATCCTAGGG
AGTTATAGCTAGGAGGGGTTTCTTACGCGGCTCGGGGGTCCACGTTCTCCCTCCTTCGTTCTGTCACTTTGCCAGGCTCTTCCCCTTCCAATGCTTTCGAAAGATCAACGTGCTTTTGAA
AAGGAAGATAAACATGCTTTGTATGTGCAGGCTGGAAATGGGCGGGAGGAGAAGAAAGTGGCCCCTTCGGTGCAGATCCCGAGTACCATTGAAGTCAGTGACGATGAGGAAGATGATCTA
TGGGAGCACATTGCTTCCATTCTGGAGGCGCGAAAGCGGGGCAGTGGTCACTCGAAG
GTCAGAACCGCTTCTTACCCTCCTTTCTTCTTTCTTTGGTGTGCTGCCTTCCAAGGTTTCGCG
GCGAAGCTGATGGGCTTACTGCCGTCAAATATCTATCGCAACCCGTCTGCTTCAAATGTACACTCCCCTTACTGTCACTCTCTTCTTGCTGTGTTGGAAGACTAGAGAAGATCAGATCTT
GGGAATGAAAGGTACTTCTGGGTGTTCCAATAGCCCTTCGTTTTGGAACTCATCACAGCTCTTCCAAGAATTCGAATTTCGCCACACTCATTGTTCCCAACTTTCAAGTTCCCTTTTCTA
GATCTATTTTCTTGGGACATGTGTTTTGTAGGTATAGAAAGAGAATACTGAGGACACCTTTCGTTCAGCTGCTGACACATGATGTAGGTTTAGCGCCGACAGAAGAAACAGCCCTGCACT
GATGTGCTTATTTTGATGCACACTCCTTATGCCATGTATCGATCTGCTGGACCGGAACAACCGAGGTTTTTGAGCAGAGAAATTCAATGGTTCGGAGGGGAAGAAAGATTGATCAATGTC
GAAAGGTGATGATGGATGAGTTGTACCTTCTGCAGCTGAGTGCTGAAGACGACGAGGAAGTCTGGCGCATCATTGAGCAGATCGTGGCCGCCCGGGCGCGTTCACACCCAGCCTTCCAAT
CCCCCGATAAGGCCAGCACCCTCAGTGTGAAGGAGCTCCGGCGCTGGTTTGAGAGCCAGGCGGTGGAGCGCGCGGGTCAGTCTAATTCTGCCAAAGCTCGGGGGGAAAGGGGCCTGCGAA
AACCTGGAGAACTCGAGAATGAACCCCTTGTGGAGGGTAAGAATGGGCTCCACAGGCAGGGTGAGAATGGGGTTCAGGGGCGGGGGCAGAATGGGCACCGGGAAAGTAGTTACGGGGAGA
AAATCTCGGTTAAGGCCGTTTTATCGGACGAAGAGTCGCCCAATTCAAAGCGGGAGTGGGCGGCATTGAAAGAGGCTGCGTTGCTTGGAAATAATTTTGGTCGGGCAGGAGGAGAGGAAG
GAAGAGACGTGAAAAGTAAGGAAGATCCACTAGGAGAGAGGAGAGAAGTCGGGACTGCTTCGACGGCGAGAAAAAAAAGCGAGGCAGAAGCAGCGGAGGCGGCCCCTAAGGCGAGTAAGA
TTGTGCGGAGGCGAAAATCGATTCCGAGCGAGAGCGATCTCAATGCCATGGTGGCTAACTTGGATGAAAACGGGGGCCAGTCGGAAAGGGAAAAGGGAGAGGAGAGAAAGGAAGACGCTG
ATGAAAGGCACTCAAATGGAGATCAGGGAAAGAAGGTGGCGGTCAACGGAGATACTGGTTTGGAGCAAGTGTCCGTGTCGGGGGGGTCCGAATACAGGGGTCCGGCCGGGGGGGAGGACA
GGGTTGTGGTCTACATGACGTCAGTGCGAGCG
GTAAGTGGCCTGCGCTTTTGCTCGTCAAGTACAGATGCGGGGCCATTGCCTAGTTCACGTATTTCTCTTAATCAAAGCTAGCTTTTTT
TCTCCCTCGTTCCTTTCGTTCTGCTTTCTCTTGATTGCATTGTCTTTGTGTCGTTTGACTGCATAAGTCGAATGTGTTCCTCGTCTGGGCAGTCACGAGAGGAAGTATTCATGCCTTGCT
CACAGCCTAGTTTCCTTTCCCATTCAGTCGACGTTGGTCTCGTCACAAGGCGTGCTCCCATCTTTCGGTCCTTATTTCCTGCTTGAACGTGCGACTCTCCGCTCGTTTCCAATCTCTGGT
CCCCTGCTCCGACCTCTGCTGTGATCGAGCGTTTGATTGTCGACTTGATTTGTGTGCCGAACTTGTTCGTCCAACGTTTTGTTTCTTGTCTTCAGGCCCTGCGACGCACATGCAATAGGG
CCCTTTCCAAAACTCGGATGACTCAGACGCCATCAGAAATACGACGCGGATCCTGCAGTCGAAGCTTTTGCTTGCAACCTCAGGAGCGCGGAACATATAAGAACTGCGCAAAAGTTGCGT
TAGACTCCAGCCCTTGTGTGCACCGCCGAATACCGGCAGATACTTCAATGTTTCAAACTGAAACATCAAATCGTACATCCTAACAAGTGCGGTAAGAATTCGGGGACTGCACAATTGTGC
GTAAGGCCGTCAGCCGTGTGGATCGACCACCATACCAACGTTGCAGTACTCTCAGCTTCCAGAACATCCATCGTCACGAACTATCTGAACAGGTGCGCAAAACGTTTGAGGAGTGCGCGA
CGGTGCGTCAGATCTTCCACGGCTTCAGCATCGCCGTGGACGAGCGTGACATCAGCATCCACCTGCCGTACCGCCAGGAGATGCGGGACCTTATGGGGGGGCGCCTCGTCAACGTTCCGC
AAGTGTTCATCCGGGGAAAGCACATTGGGGGAGTCCAG
GTGAATCTCTTCGTGTTCCTTCAATATCACATGAAAACCCTCGGAATGACTTGTCATTGAAAAGAGACGAAAGTAAGCACTT
ATGTTGTGGAATTGTTGAAAGGGCCGGCACGTCATCGTTCCGCAATTGTTTATTCGGAGGAAGCACATCGGGGGCTGCAAGTGAGGGCTTTCCCTTCGTCTCCTATTTAATGCAAATTTC
GTTTGATCGCGCCAGAAAACCTCCTTTCCAAAGGTATCTATGAATTGAGGTGGGACAGCTGTCTGCGTTGAACTTGCCATCGGGTTCCCACTTTTTCGAGCCAAGTTCCTGATCATGAGC
CGTCCGATGCCATCCTTGTCATCGATCGGACGGTACAAGATCAGGACCCATGCTCCGAGAATTTGGAACCCGACGATTCAAAGAGCTATCCCATAATTCGGAAGGTGGCTGGACACTGAT
GCACGCGTCTTATTCTAGGGCAATACTTGAGGGGTTTTTCGGTGAGCTTCTGGATGATCCGCACAGATGTTGCATTTGCAAGGGTTTTCTGTTTTTTTGGGGGATGTATGGGATTTCGCT
CGATGTTCTGTCGCAACTTCTCAGTTGAGGAGAACGCAGACATTAAGACAGGCATCTCCTTGCGATACCTTGCTCGTTGCATTTAGCAATCTGGAAAGAATGTGATTGCAGATTGTTGTC
TTGGTTTCTGTTTCTTCGCGGTCTATCAAACGCGTTCCCAGTCAAGCGTGTCGATTTGGCAGCGCCAGTCGAGGCCTCCATTCCTGGTCACTTCCGAACTTCCATCTCCCCCTCATTCTG
AAAACCCTCTGTCGTTGGTTTTAACGAGCTGTCAATTGAACACATCCGTCTGTGGTTGCAGGAGGTGCGATTTCTCGCGGACGAGAAAAAGATGCACGAGCTTCTCGTTGGCATGCCCAG
GATCAAGTTCACAGAGGAATGCGGGGGCTGTGGGGGTGGAAAGTTTTTGCCGTGTGTCGACTGTCGAGGCAGCCGGAAGATCATAGTAGGGGACAAAGTAGAAACGTGCTTCGCGTGCAA
TGAGTACGGGCTGATACGGTGTCCAATGTGCGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTCTGTATCAATGAGTGCTTTAGGGTTTGCAGCACTAGCTCTGGCTGCTGGGGTATGGGTGCTTGGAGGACGGCATGCTGGAAATGGGCGGGAGGAGAAGAAAGTGGCCCCTTCG
GTGCAGATCCCGAGTACCATTGAAGTCAGTGACGATGAGGAAGATGATCTATGGGAGCACATTGCTTCCATTCTGGAGGCGCGAAAGCGGGGCAGTGGTCACTCGAAG
CTGAGTGCTGAA
GACGACGAGGAAGTCTGGCGCATCATTGAGCAGATCGTGGCCGCCCGGGCGCGTTCACACCCAGCCTTCCAATCCCCCGATAAGGCCAGCACCCTCAGTGTGAAGGAGCTCCGGCGCTGG
TTTGAGAGCCAGGCGGTGGAGCGCGCGGGTCAGTCTAATTCTGCCAAAGCTCGGGGGGAAAGGGGCCTGCGAAAACCTGGAGAACTCGAGAATGAACCCCTTGTGGAGGGTAAGAATGGG
CTCCACAGGCAGGGTGAGAATGGGGTTCAGGGGCGGGGGCAGAATGGGCACCGGGAAAGTAGTTACGGGGAGAAAATCTCGGTTAAGGCCGTTTTATCGGACGAAGAGTCGCCCAATTCA
AAGCGGGAGTGGGCGGCATTGAAAGAGGCTGCGTTGCTTGGAAATAATTTTGGTCGGGCAGGAGGAGAGGAAGGAAGAGACGTGAAAAGTAAGGAAGATCCACTAGGAGAGAGGAGAGAA
GTCGGGACTGCTTCGACGGCGAGAAAAAAAAGCGAGGCAGAAGCAGCGGAGGCGGCCCCTAAGGCGAGTAAGATTGTGCGGAGGCGAAAATCGATTCCGAGCGAGAGCGATCTCAATGCC
ATGGTGGCTAACTTGGATGAAAACGGGGGCCAGTCGGAAAGGGAAAAGGGAGAGGAGAGAAAGGAAGACGCTGATGAAAGGCACTCAAATGGAGATCAGGGAAAGAAGGTGGCGGTCAAC
GGAGATACTGGTTTGGAGCAAGTGTCCGTGTCGGGGGGGTCCGAATACAGGGGTCCGGCCGGGGGGGAGGACAGGGTTGTGGTCTACATGACGTCAGTGCGAGCG
GTGCGCAAAACGTTT
GAGGAGTGCGCGACGGTGCGTCAGATCTTCCACGGCTTCAGCATCGCCGTGGACGAGCGTGACATCAGCATCCACCTGCCGTACCGCCAGGAGATGCGGGACCTTATGGGGGGGCGCCTC
GTCAACGTTCCGCAAGTGTTCATCCGGGGAAAGCACATTGGGGGAGTCCAG
GAGGTGCGATTTCTCGCGGACGAGAAAAAGATGCACGAGCTTCTCGTTGGCATGCCCAGGATCAAGTTC
ACAGAGGAATGCGGGGGCTGTGGGGGTGGAAAGTTTTTGCCGTGTGTCGACTGTCGAGGCAGCCGGAAGATCATAGTAGGGGACAAAGTAGAAACGTGCTTCGCGTGCAATGAGTACGGG
CTGATACGGTGTCCAATGTGCGCTTGA

Retrieve as FASTA