Entry information : KflUCC01 (Kfl_000080540)
Entry ID 14063
Creation 2016-10-26 (Christophe Dunand)
Last sequence changes 2016-10-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-26 (Christophe Dunand)
Peroxidase information: KflUCC01 (Kfl_000080540)
Name (synonym) KflUCC01 (Kfl_000080540)
Class Uclacyanin    [Orthogroup: UCC001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflUCC01
start..stop
S start..stop
ThasUCC02-2 75 2e-17 1..141 1..132
AtSTC04 67 0.000000000000002 32..137 11..106
AtUCC06 69 0.000000000000002 1..136 1..122
HaSTC08 67 0.000000000000004 32..157 28..141
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 428590..428658 69 N° 2 428013..428121 109 N° 3 427388..427568 181 N° 4 426660..426783 124
complement(join(426660..426783,427388..427568,428013..428121,428590..428658))


exon

Literature and cross-references KflUCC01 (Kfl_000080540)
Protein sequence: KflUCC01 (Kfl_000080540)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   160 (133)
PWM (Da):   %s   16178.19 (13415.7)  
PI (pH):   %s   4.38 (4.01) Peptide Signal:   %s   cut: 28 range:28-160
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAREEVLQRALLAALICLGAATLGARADLVQVGGSSGWGLGINYPLWAEQNPVYVGDVLFFVFPPAIHTVFALPNNQSLTACDFSNSTNLSQPNNSNVAPGLVGVNVPVSAPGPDYYACEVDGHCLDGMKVAINVLPGPRPVLAPAPAPGAGIAAGPSGA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGCGAAGAGGTGTTGCAACGGGCACTTCTCGCGGCTCTAATTTGCCTTGGCGCTGCTACGCTGGTGAGGAGCACGTTCTGCGATTCCCTTCTCTGACTCCCTCGGATCGTCGCT
TTTGTTGATTAGCCGTATATAAGGAGCATTCGTGGTGGAAAGCCCTTGCGTGCCAAAGTTTCTGCGTTTCCCAGAAATCGATTTGTGGGGCAATCTATTTGGTTTGGGGAGCAAAAGGAC
AGGTAGAGAACCTTTTGAAGTCGTGAAAAACCCCCCTTGGAAAGCAGCCCTCTGCCTATTGCAAGCTCTTTTTGCTGTCCAAGAAATCAGCCTTTCGACACCTGAAACGACCATTTCAAA
AATAGCCGCTTGGCCCAACTTCCAAGCTGTCAGCACGCTGACAGCACTTGCCATACTTTGAACCTGGTCAAAGGCTTTGGCAGTGCCTTTATATTTCAGTGACTGCAGAAATGCCCCATC
TTTTCACTAATATGTTGAAAAATAAACAATTACTCCCAACTCGTCTGATTGGTTCAGGGGGCAAGAGCTGACCTGGTTCAAGTCGGGGGATCGTCGGGATGGGGGCTCGGAATCAACTAC
CCGCTGTGGGCGGAGCAGAACCCAGTCTACGTGGGCGACGTTCTCT
GTGAGTCCCATATCTAGTTCTTTCCTGCTCGTTCTGGACCTCGGCGCTGTCCGGAGATGACATCATTTCTCGAT
CTCTCTTCTGACCAGATTGAACTTTTGCAACGTGAGGGGATGAGAGACGAAGTGAAAATTTCTGTCCTGGCAATCGTTCTCATTTCGTTGTGTAAGGCAGTCTTTTCGGAATTTGACCAT
CTGAGAGACCGAAGTGCTTGAAGACTGAAGGTCAGCAACATGAAAGAGGTTACAACCGGACAGGCCAAGAGAACTGAGGATTGAGAGAATGAAGCCTCTTTCCGGGGTACTGAAAGGTCC
ATTCGGCTTCAACATTTAATCAGAAAGATTGCTGCGGCCCACACGCACTTTCGCTGGCCTACCCGTCTCAGCCCTCAGCTCATTTGCCCATCTTCGAACTTCGAAAGCCTCTTTCTGTTG
TCTCGTGCAGTCTTCGTGTTCCCCCCAGCGATTCACACCGTCTTCGCGCTGCCCAATAACCAGTCCCTGACCGCGTGCGACTTTTCCAACTCAACCAACCTGAGTCAGCCCAACAACTCC
AACGTTGCCCCGGGACTGGTCGGCGTGAACGTACCGGTCTCAGCGCCTGGCCCGGACTACTACGCATGCGA
GTCAGTACCACTCCAACCAACCCTTGTCTGCATTGCGCTTGTATGCCGA
CTGCTCATTCCGTCGGATGCGCAGCGATTACCTTGTGAGAGCTACTGTAGTTCGAACTACCCTGCTTTCGGAGAATCTGAGAATTTGTGCCAGGGAGATTTATCACCAATACTCTCGACG
AGGCTGTGACCCAATACACGAAGCAAGTCGTCTTCTCTGAACAAGTTCGGTCAAAAAAAGCGGAAATGTGATTCTTGAGCGCGCGCGTTTGGATGGTGTAACCAAAGTTGTTCGAGAAAC
GTCGACGCCCGGTTTTGTGATCTCGCGTCACGGACTCGTCGGCTTTGAATCCGCGCAAGTCCGCAAAGCCCACGGAACGACACGGGCCACTTATTGTACTTCCCGTGCATGCATAGGTAC
GCGCGCTCAAAATGTGCTTCTCTGATCTCAGTAAAGGTAGACATCTGGTCGACCGATTCATCTGAGCTTCGCTTTCTGACGAATTTACAATCAGATCCCCCAATCGGCCAACCTATGGTT
TACAAATTCGAAAATGCGGAAGCGCCAGGCAAAGTTGGTACTAACTACAGATTCGTCCGTTCTGTTTCTGGGCAGGGTCGACGGCCACTGTCTCGACGGCATGAAGGTCGCCATCAACGT
TCTACCGGGGCCCCGCCCCGTGCTCGCGCCCGCGCCCGCGCCCGGCGCGGGCATCGCGGCCGGCCCTTCCGGGGCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGCGAAGAGGTGTTGCAACGGGCACTTCTCGCGGCTCTAATTTGCCTTGGCGCTGCTACGCTGGGGGCAAGAGCTGACCTGGTTCAAGTCGGGGGATCGTCGGGATGGGGGCTC
GGAATCAACTACCCGCTGTGGGCGGAGCAGAACCCAGTCTACGTGGGCGACGTTCTCT
TCTTCGTGTTCCCCCCAGCGATTCACACCGTCTTCGCGCTGCCCAATAACCAGTCCCTGACC
GCGTGCGACTTTTCCAACTCAACCAACCTGAGTCAGCCCAACAACTCCAACGTTGCCCCGGGACTGGTCGGCGTGAACGTACCGGTCTCAGCGCCTGGCCCGGACTACTACGCATGCGA
G
GTCGACGGCCACTGTCTCGACGGCATGAAGGTCGCCATCAACGTTCTACCGGGGCCCCGCCCCGTGCTCGCGCCCGCGCCCGCGCCCGGCGCGGGCATCGCGGCCGGCCCTTCCGGGGCG
TAG

Retrieve as FASTA