Entry information : AtTDX01 (AT3G17880|ATHIP2/ATTDX/HIP)
Entry ID 14117
Creation 2016-10-27 (Christophe Dunand)
Last sequence changes 2016-10-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-27 (Christophe Dunand)
Peroxidase information: AtTDX01 (AT3G17880|ATHIP2/ATTDX/HIP)
Name (synonym) AtTDX01 (AT3G17880|ATHIP2/ATTDX/HIP)
Class Thioredoxin Type TDX    [Orthogroup: TDX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtTDX01
start..stop
S start..stop
ThasTDX01 489 8e-175 2..369 1..349
HaTDX01 462 4e-164 2..371 1..364
PpaTDX01 233 2e-73 2..236 1..268
KflTDX01 184 2e-54 71..252 143..338
KflTDX01 50 0.0000005 2..44 4..46
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 126..238 113 N° 2 358..391 34 N° 3 574..693 120 N° 4 789..876 88
N° 5 953..1033 81 N° 6 1117..1181 65 N° 7 1341..1481 141 N° 8 1568..1681 114
N° 9 1885..1915 31 N° 10 2371..2705 335  
join(126..238,358..391,574..693,789..876,953..1033,1117..1181,1341..1481,1568..1 681,1885..1915,2371..2705)


exon

Literature and cross-references AtTDX01 (AT3G17880|ATHIP2/ATTDX/HIP)
Omic ref. AtProteome:   At3g17880 ATTED-II:   At3g17880 e-FP Browser:   At3g17880 ePlant:   At3g17880 TAIR:   At3g17880
Protein sequence: AtTDX01 (AT3G17880|ATHIP2/ATTDX/HIP)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   374
PWM (Da):   %s   41884.26  
PI (pH):   %s   5.55
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVDAIQVAELRRFVEQLKLNPSILHDPSLVFFKEYLRSLGAQVPKIEKTAETKPSFSPKHDDDDDDIMESDVELDNSDVVEPDNEPPQPMGDPTAEVTDENRDDAQSEKSKAMEAISDGRFDEAIEHLTKAVMLNPTSAILYATRASVFLKVKKPNAAIRDANVALQFNSDSAKGYKSRGMAKAMLGQWEEAAADLHVASKLDYDEEIGTMLKKVEPNAKRIEEHRRKYQRLRKEKELQRAERERRKQQEAQEREAQAALNDGEVISIHSTSELEAKTKAAKKASRLLILYFTATWCGPCRYMSPLYSNLATQHSRVVFLKVDIDKANDVAASWNISSVPTFCFIRDGKEVDKVVGADKGSLEQKIAQHSSSK*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGATGCGATTCAAGTAGCTGAGCTGAGAAGATTCGTCGAGCAGTTGAAATTGAATCCTTCGATTCTCCACGATCCTAGTCTGGTTTTCTTCAAAGAATATCTCCGAAGGTGATTC
ATTCTTCTCTGACTTATCTTTCTTTCGGTGAATTTCATTTGTCAGTTGAATTTTTCCATGGAGCTGTGAGTTTCTTTGTAATCGATGCTCGTTCCCGTCTTATCGTGTACAGTTTAGGAG
CTCAAGTTCCGAAGATTGAGAAAACT
GTAAGTTGTCTTTCTTATGAATTATCGATGTTTAGGTTTCTCTTGTTTGTGCTACTTGGGATTGAGTTCTTAATATCTTTGTGTTGAATTGATG
TACAAAACCCTTTTCTAGGCTTCAACACTATCTAAATGTTGATCGAATAGTTAACTATAAATTGCAGGAAAGAGATTATGAAGATAAGGCTGAGACAAAACCCAGTTTCTCTCCTAAACA
TGATGATGATGATGATGATATTATGGAGTCTGATGTTGAACTCGACAACTCTGATGTAGTTGAACCAGACAATGAGCCTCCTCAGCCG
GTAGGTGTTGAAGTTATCATCTTTGGATATTA
TGTGGTGCTTGTGTCTCTATGCATTTTTTTACCTGATTGGATGATTTTACTTTCTTGTCTTAGATGGGAGACCCTACTGCTGAAGTGACCGATGAAAATAGGGATGATGCTCAGTCAGAG
AAGAGCAAAGCTATGGAGGCAATCTCTGATG
GTACATAACTACCGTTGAAATTGGTTTTGATTATCTACTTCATAAGATTTCTCCTTAATGCTTGATTGGTATACAGGGAGGTTTGACGA
AGCTATAGAGCATCTAACAAAAGCTGTCATGCTAAATCCTACTTCAGCGATTCTCTACGCCACTAGAG
GTAACTTTCTTTTACTAGTTCACTCTCCCTTTTCGGCTGAATGTGGGTGATA
ATACTCAATATTTGTGATTGTTGTCCTGCAGCTAGTGTGTTTTTAAAAGTTAAGAAGCCAAATGCTGCAATTCGTGATGCCAACGTAGCGTTACAGGTGATCATTTCTCTTGACATAAAC
TTGTTTTGTTTGTGCTGAAAATGGATTTGGTAAAACAAGTTTATGTCTCAATAGTTTTATGGCTTGGGAGAGTGATTTTATATCTCAATGGTTTTCTTCCATAAACAAGCTAAACTAGTT
TATTTTGGGGTTTAGTTCAACTCTGATTCAGCTAAGGGGTACAAATCACGAGGTATGGCTAAGGCCATGTTAGGCCAATGGGAAGAGGCTGCAGCTGATCTACATGTCGCATCAAAATTA
GATTACGATGAGGAGATAGGGACAATGCTTAAGAAG
GTAATTGCGGAAACCTCTTGATATCACTGTATGGTCCTTGAGTTTTACAGTACCAAATATATATGCTGAAAATGTGTACTTCCC
AGGTTGAACCCAATGCAAAGAGAATCGAAGAACACCGCAGGAAATACCAACGCCTGAGGAAAGAAAAGGAGCTCCAAAGGGCTGAACGCGAGAGACGGAAACAGCAAGAAGCCCAGGTCA
GACCGACTCATACCCATAATTAAATGTTGTGTAGAGTTACATTCTTTTGATTATCTTCTTAGCAGAAATCACATAGGCCTGATTATCTTCTCCCTGTGAGAGTTAAAATATAACCTCTTC
TGATATTATCAATATCATATCATATCAAACATCTCACGCTCATTGATTTGCTTCTTGCTCGTGAATCCTATCAATGCAGGAGCGAGAAGCTCAGGCTGCACTCAATGACGGTAAACATTT
TATCCATTTCTTTCAACGGTTTTCTACTTCATGATATTTTTGCAAAGAACTAATTATGTGTTGGAACATTTATCTGTGAGTCTTGCCCCAATGAATTGTCTTCACTCAATAAGAAGCAAA
GCTCAATATGCTCTTGTTAGCCACTAAATCCAGTTGATAAGGCCACTAACCAGCATGCTTATCCCGCATGCAGTCTCATTTGCATTCACTTACCTGAGAAATTCTGCTAATCCAGACCAG
AACCGTAACCTCCCAACAAAAACTAATTTAGGGGATAGTTTAGTGGAAACTCATGGTGTATTGACGCCTCACTAGCTTTCTGTTTCTTGCATGTATCGTAGATCCCAGTTATTCTCACAA
AGCTTCATTTACAGCTTTTATAAAACTTAAAATGAAATTTGCATGTCAAAAAGGAAATGATCATCTTTTCTCCCTGATGATACAGGAGAAGTGATTAGCATCCACTCAACAAGCGAGCTA
GAAGCAAAGACAAAGGCTGCTAAGAAGGCATCACGTCTGCTCATCCTTTACTTCACAGCCACATGGTGTGGGCCATGCCGATATATGTCTCCTCTGTACTCAAACCTGGCCACACAGCAC
TCGAGAGTCGTTTTCTTGAAAGTTGATATAGACAAGGCCAATGACGTGGCTGCTTCTTGGAACATTAGCAGCGTCCCGACCTTTTGCTTCATCAGAGATGGCAAAGAGGTGGACAAAGTT
GTCGGAGCTGATAAAGGTTCGCTTGAGCAGAAGATTGCACAGCACTCTTCTTCTAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGATGCGATTCAAGTAGCTGAGCTGAGAAGATTCGTCGAGCAGTTGAAATTGAATCCTTCGATTCTCCACGATCCTAGTCTGGTTTTCTTCAAAGAATATCTCCGAAGTTTAGGA
GCTCAAGTTCCGAAGATTGAGAAAACT
GCTGAGACAAAACCCAGTTTCTCTCCTAAACATGATGATGATGATGATGATATTATGGAGTCTGATGTTGAACTCGACAACTCTGATGTAGTT
GAACCAGACAATGAGCCTCCTCAGCCG
ATGGGAGACCCTACTGCTGAAGTGACCGATGAAAATAGGGATGATGCTCAGTCAGAGAAGAGCAAAGCTATGGAGGCAATCTCTGATGGGAGG
TTTGACGAAGCTATAGAGCATCTAACAAAAGCTGTCATGCTAAATCCTACTTCAGCGATTCTCTACGCCACTAGAG
CTAGTGTGTTTTTAAAAGTTAAGAAGCCAAATGCTGCAATTCGT
GATGCCAACGTAGCGTTACAG
TTCAACTCTGATTCAGCTAAGGGGTACAAATCACGAGGTATGGCTAAGGCCATGTTAGGCCAATGGGAAGAGGCTGCAGCTGATCTACATGTCGCATCA
AAATTAGATTACGATGAGGAGATAGGGACAATGCTTAAGAAG
GTTGAACCCAATGCAAAGAGAATCGAAGAACACCGCAGGAAATACCAACGCCTGAGGAAAGAAAAGGAGCTCCAAAGG
GCTGAACGCGAGAGACGGAAACAGCAAGAAGCCCAG
GAGCGAGAAGCTCAGGCTGCACTCAATGACGGAGAAGTGATTAGCATCCACTCAACAAGCGAGCTAGAAGCAAAGACAAAGGCT
GCTAAGAAGGCATCACGTCTGCTCATCCTTTACTTCACAGCCACATGGTGTGGGCCATGCCGATATATGTCTCCTCTGTACTCAAACCTGGCCACACAGCACTCGAGAGTCGTTTTCTTG
AAAGTTGATATAGACAAGGCCAATGACGTGGCTGCTTCTTGGAACATTAGCAGCGTCCCGACCTTTTGCTTCATCAGAGATGGCAAAGAGGTGGACAAAGTTGTCGGAGCTGATAAAGGT
TCGCTTGAGCAGAAGATTGCACAGCACTCTTCTTCTAAGTAA

Retrieve as FASTA