Entry information : KflClot01 (KFL_000730250)
Entry ID 14185
Creation 2016-10-27 (Christophe Dunand)
Last sequence changes 2016-11-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-11-09 (Christophe Dunand)
Peroxidase information: KflClot01 (KFL_000730250)
Name (synonym) KflClot01 (KFL_000730250)
Class Thioredoxin Type Clot    [Orthogroup: Clot001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflClot01
start..stop
S start..stop
AtClot01 92 1e-24 47..165 1..120
HaClot01 91 3e-24 57..176 9..130
ThasClot01 86 2e-22 76..166 32..120
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 188023..188057 35 N° 2 187236..187325 90 N° 3 186791..186942 152 N° 4 186131..186384 254
complement(join(186131..186384,186791..186942,187236..187325,188023..188057))


exon

Literature and cross-references KflClot01 (KFL_000730250)
Protein sequence: KflClot01 (KFL_000730250)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   176
PWM (Da):   %s   19351.94  
PI (pH):   %s   8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHHAGQGQGPAGRAPARFLSREGAEQWEQTHLRTLAREAVCRWCAIMVLTKVLTAPSASQLNPMLEELSGARHLYVLFLGSPVAEDKPSWCDCVRGEPEILKSLAASSKHINLLRVYVGDRPTWRDPSHPLRTDPKLSQFIRGVPSLVSWGSDGPLKSLGDQEAQDQELVRQLVG

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCATGCAGGGCAGGGACAGGGACCAGCAGGGTGCACAGTGCACACTGTCAAGCAAGCTGAAGATCGGTGTCAGTGAAGCAAGAGGCACAAAGCAGCCGAACTTTTCTCGGAAAAA
CGGATGCGGACACCGTCCAATTTGACCAACCGGGCACTGATTCAAGACTACCGGGAACCTCACCAACACTAAAAGCCTAAGAATATGCCCAAGCCGTTAGTATAACCCTAATCGTAGTGC
AGTCACAATAAGGTTGCACGACCCTAAAAAACCGTCACAGGCTTGCAACATAACCCTAATGTCACAGGGGGGCCCGGTTGCTTGTCGGCGGTTCCAGGTCCGAACAGTAGCGCACAGGCG
TCCGCAACTTTTTCCGAGAAAAGTTCGGCTGCTTTGTCCGTTTTGCGTCAGTGAACAGCCTGTGAACTTTGAAGTGTGGTGTTTAAAACTTTAAAAGCGGACTGACTGCTTGCTTAAACC
CCGGGCCGAATTCACAGCCGTCCATCTCAGTGATGGCACAGCTGACGTCCGTCCGATCAAGGGTTTCACTCAGCGGCCGCGGTAACCAAGCCTGGGCCGCCCGCGCAACCCCGAAAAGTC
CAAAAATTCAGTGCGCCTATAGGCTATAGCTGCCGCCATGCTAGCAATATTCATGCAGTGGAGGGGCCATCTAGATTCTACTGTAATTTCTAGAACAATTGAGGCGTTGAGGTGAGCTAG
AACTAATAGCAGGAGAGCCCCAGCAAGATTCCTCAGCAGAGAGGGAGCAGAACAGTGGGAGCAGACTCATCTGAGGACTCTTGCAAGAGAGGCTGTCTGCAGGTAATATCCTTTTTCTTC
TCTGCTGCTTGCTTGATGAGCTGGAAGAAGCGTACAATTCAGTCCTTCTCTTGGGGACAGCTGATACCCAATTCTGATTGGGCCTGTTCCTGATGCTTTAGAACAGTCTCTAACTTCCCT
GAGCTCGAAGAGATAGAAGGGTTAGCTGCTAGTCTCTAAAGCAAGCTGCCAGCGAAGCGTGCAAAATTGCATAAGGTTCCCCAAAATTTAAGCTTAAAACCTCGACATGATTAGCCTGTT
TTGAGAATCGCAGTTGAGCTAAGTTTTCCTGGCAGGTGGTGTGCCATCATGGTGCTAACAAAAGTCCTTACAGCCCCATCAGCATCGCAACTGAATCCAATGCTGGAAGAACTGAGCGGC
GCACGTCATCTATATGTCCTTTTCCTGGGAAGCCCCGTTGCAGAGGACAAACCAAGCTGGTGCCCTG
GTAAGGCACAACTCAATTTCAGACTTGTGACCAATGCTGGTTACAAGGATGCT
TTGGAAGCTTTGCTTTCGGCAGTTGTTATCTTAAGAGGCAGAATAGTCGGGTGCCTGTGAACATGTTGAAAGTCTACGCCTATATTGACGAATCGCCGCAAGGAAGATCTCCTCTCTTAT
TAGGAGGGACCTGTTTACTTAATTTGTATCGGAGGTCACTCGATTCGAGATGTGTGCATTCAGCAAATGAGCTGGCTTGTCAATAGCAAGCAAAGAAGCGTTGCATCTAGCCGTTGAGGG
GACAAACATGAAGTACAATCAGGTTTCATTTGAACATGGCCCTGAAGCTTGGTTGAGGATAATGATGAGGATATTGCATCTGTTACAAGAAGCTGCTTTGCTCTAAACCGCAGACTGTGT
GCGTGGGGAGCCTGAGATCCTCAAATCCCTCGCCGCTTCCTCAAAGCACATCAACCTTCTACGGGTCTATGTCGGAGACCGTCCAACATGGAGAGACCCATCTCACCCACTAAGAACAGA
TCCAAAGCTGTCCCAGTTTATCAGAGGCGTGCCCAGTCTTGTGAGTTGGGGCAGTGACGGTCCTCTGAAGAGCCTGGGCGATCAGGAAGCTCAGGACCAAGAGTTGGTTAGGCAGCTTGT
AGGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCATGCAGGGCAGGGACAGGGACCAGCAGGGAGAGCCCCAGCAAGATTCCTCAGCAGAGAGGGAGCAGAACAGTGGGAGCAGACTCATCTGAGGACTCTTGCAAGAGAGGCTGTC
TGCAG
GTGGTGTGCCATCATGGTGCTAACAAAAGTCCTTACAGCCCCATCAGCATCGCAACTGAATCCAATGCTGGAAGAACTGAGCGGCGCACGTCATCTATATGTCCTTTTCCTGGGA
AGCCCCGTTGCAGAGGACAAACCAAGCTGGTGCCCTG
ACTGTGTGCGTGGGGAGCCTGAGATCCTCAAATCCCTCGCCGCTTCCTCAAAGCACATCAACCTTCTACGGGTCTATGTCGGA
GACCGTCCAACATGGAGAGACCCATCTCACCCACTAAGAACAGATCCAAAGCTGTCCCAGTTTATCAGAGGCGTGCCCAGTCTTGTGAGTTGGGGCAGTGACGGTCCTCTGAAGAGCCTG
GGCGATCAGGAAGCTCAGGACCAAGAGTTGGTTAGGCAGCTTGTAGGTTGA

Retrieve as FASTA