Entry information : HaClot01 (HanXRQChr01g0018511)
Entry ID 14241
Creation 2016-11-28 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaClot01 (HanXRQChr01g0018511)
Name (synonym) HaClot01 (HanXRQChr01g0018511)
Class Thioredoxin Type Clot    [Orthogroup: Clot001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaClot01
start..stop
S start..stop
ThasClot01 173 2e-57 1..131 1..131
AtClot01 162 6e-53 1..119 1..120
KflClot01 91 2e-24 9..130 57..176
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 109945488..109945632 145 N° 2 109944170..109944423 254  
complement(join(109944170..109944423,109945488..109945632))


exon

Literature and cross-references HaClot01 (HanXRQChr01g0018511)
DNA ref. HanXRQ genome:   HanXRQChr01 (109945632..109944170)
Protein sequence: HaClot01 (HanXRQChr01g0018511)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   132
PWM (Da):   %s   14895.75  
PI (pH):   %s   7.51
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPLKTVDATLSTFNAVFEKFKSEAPNNKNNLILFLADNEPSTNRSWCPDCVRAEPVIYKKLESSGDDVALLRAYVGDRPTWRNPLHPWRVDSTFKLKGVPTLILWEKGEVKGRLEDHEAHIEKKIDSLLATK

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTTGAAGACGGTTGACGCTACCTTATCGACCTTCAACGCCGTCTTCGAGAAATTCAAATCAGAAGCACCAAACAACAAGAACAATCTCATCTTGTTTTTGGCTGATAACGAACCT
TCCACTAATCGCAGTTGGTGCCCTG
GTAATACCATTGCATATTCTCATTACTGATTTCAGTTTCCAACTTTAATTAATACTTGTTAATTTCAAACCTAGGGTTTTTCTTTCACTTGATTA
TTGCTGTAAACTTTAATGTAGTTCAGTCGTTGTAAGTTTAATTTGTTCTAAAAAGATGGAATTAAGTTTAAAACTTGTTTTATGATCTTTTTAAGAGAGTAAAATGGTGAATTTTTTTTT
CTGAAAGTTGTAGTGCTAGGAGAGGAATGTTACCCTAATTTTTTTTTTTTCTTCCAAATTTTGATGCATTTTCTGTTAAATTTAAGGTATAGTTGTCGAGTGTAGACTACTGTTGCATTA
ACAAAAATTTGGGGGAAAAATTGGATTTCTAGAAGAAGTAATTTGGACCCGACTTGTTGAAATTAGGGGTGTAAACAAGCCCAGAGGCTCGAGAGCTACTCGTTATCGTTATCGGCTCGG
TTAAAAGCTCGAACGAGTCGAGCTTCGACGAGCCAGAGCTCGAGCCTGTAATAGAGCTCGTTTTGTTATCGATCCCAAGTTCGAGTCTGAAATACAAGCCCAAACAAATTTTACATTTTA
TATATATAATATATAAAGTAACAATAATGATGATAACATTGGCGAGCCAAGCTTCGGCTCGTTTAAGCGATGTTGAAGCGAGCTCGAGCCGAGCTTTTAGTTTGTTTGAGGTTGTTCTCA
AAATAGCTCGAGTTTTGGGTTTAGCTTGCGAGCCGAGCTCGAGCTCAAATAAGTAGGCTTGAACTGAGCCGAGCTCTAGCTCAAGCTTTCATAAAAACACGATGAGCCGAGCTCGAGCCT
AGTTTGGCTCGGGCTCGGCCCGGCTCGTTTACACCTCTAGTTGAGATGTTTCGACAATATATTGTGGCCATGTAACTCCAAACAGCATGGAAGTTATGTATGTTTTAAGTTGGGTCATTT
TCTAGCCCACTTACTTTTATCGTGTTGGTCCAAATATGACTATGCTAATTCTTGTATGAGTTTGTTGCAATGGGAAAGAATTGAAAGTTGTTTCATACTTTCATTGACTTTTATCTTTCT
TTTTCACAGACTGTGTGCGAGCTGAACCAGTTATATACAAGAAACTTGAATCATCAGGCGATGATGTGGCACTCCTGAGGGCTTATGTTGGGGACAGACCCACGTGGAGGAACCCACTGC
ACCCATGGAGGGTGGACTCGACGTTCAAGCTGAAAGGAGTCCCGACTTTAATCTTATGGGAGAAGGGTGAGGTTAAAGGTCGCCTTGAAGACCATGAAGCACACATTGAGAAAAAGATTG
ACTCGCTTCTCGCCACCAAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTTGAAGACGGTTGACGCTACCTTATCGACCTTCAACGCCGTCTTCGAGAAATTCAAATCAGAAGCACCAAACAACAAGAACAATCTCATCTTGTTTTTGGCTGATAACGAACCT
TCCACTAATCGCAGTTGGTGCCCTG
ACTGTGTGCGAGCTGAACCAGTTATATACAAGAAACTTGAATCATCAGGCGATGATGTGGCACTCCTGAGGGCTTATGTTGGGGACAGACCCACG
TGGAGGAACCCACTGCACCCATGGAGGGTGGACTCGACGTTCAAGCTGAAAGGAGTCCCGACTTTAATCTTATGGGAGAAGGGTGAGGTTAAAGGTCGCCTTGAAGACCATGAAGCACAC
ATTGAGAAAAAGATTGACTCGCTTCTCGCCACCAAATGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATAATCTAC CCGTGCCCGT TGATGAAGGG AGTGTATTGT ATATTTCATA AAGTATAAGG TTGATATGTG ACAATCATCA TCTTGTTGTG TATAAATCAT AAACGAAGAA TCAATCAATC  GTATCCCCAT TGTTGTAAGT AAAAAAGATG CCTTTGAAGA CGGTTGACGC TACCTTATCG ACCTTCAACG CCGTCTTCGA GAAATTCAAA TCAGAAGCAC CAAACAACAA GAACAATCTC  ATCTTGTTTT TGGCTGATAA CGAACCTTCC ACTAATCGCA GTTGGTGCCC TGACTGTGTG CGAGCTGAAC CAGTTATATA CAAGAAACTT GAATCATCAG GCGATGATGT GGCACTCCTG  AGGGCTTATG TTGGGGACAG ACCCACGTGG AGGAACCCAC TGCACCCATG GAGGGTGGAC TCGACGTTCA AGCTGAAAGG AGTCCCGACT TTAATCTTAT GGGAGAAGGG TGAGGTTAAA  GGTCGCCTTG AAGACCATGA AGCACACATT GAGAAAAAGA TTGACTCGCT TCTCGCCACC AAATGAACAT CCTGATGACC AGACCACCAT GGTTGCATAA TAAGCTGCAT CTGCTATATG  ATGTTTAGAC TTGTTGACCA TAGAATAATT GAGGTTATGA CATCAAATAT GTTTTGAGTT TAATACTATG CAAGATCGTG TTGGGATTAA TTAATAGTTT GCCTTACTTT ATGCTGGAAT 
TTTATGGGTA TATTCTTTCA AACTTGAAGG TTGGCTGTGT TAGCCTTGGA CCGGGAAACC GGCCGGTCGG ACTGGTTTTT GGAAGGGTTG GACCGGTTTT TTATATATAT ATATAG 

Retrieve as FASTA