Entry information : HaTrx09 (HanXRQChr16g0532191)
Entry ID 14242
Creation 2016-11-28 (Christophe Dunand)
Last sequence changes 2017-11-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaTrx09 (HanXRQChr16g0532191)
Name (synonym) HaTrx09 (HanXRQChr16g0532191)
Class Other Thioredoxin    [Orthogroup: Trx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaTrx09
start..stop
S start..stop
AtTrx03 345 9e-116 59..370 86..391
ThasTrx03-1 342 8e-115 59..370 65..370
ThasTrx03-2 339 2e-113 59..370 77..382
HaTrx08 332 3e-110 59..370 91..405
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 184584675..184585749 1075 N° 2 184580208..184580278 71  
complement(join(184580208..184580278,184584675..184585749))


exon

Literature and cross-references HaTrx09 (HanXRQChr16g0532191)
DNA ref. HanXRQ genome:   HanXRQChr16 (184585749..184580208)
Protein sequence: HaTrx09 (HanXRQChr16g0532191)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   381
PWM (Da):   %s   40416.64  
PI (pH):   %s   7.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQPCCPKLLNLLYKARKLIGIATIGSSSAAATDAIISTTKFSTTTSAAMDDLQTLKTRLCIIGSGPAAHTAAIYAARAEIKPLMFEGWMANDIAAGGQLTTTTDVENFPGFPEGILGFELMERCKQQSLRFGTQIYSETVNKVDFSSAPFKLFTDSKTVVADSVIVATGAVARRLTFPGSGEGKLGFWNRGISACAVCDGAAPIFRNKPLAVIGGGDSAMEEANFLTKYGSKVYIIHRRDEFRASKIMQQRALSNSKIEVIWNSAVVEAYGEEGKNVLGGLKVKNVVSGEVSDLKVNGLFFAIGHEPATKFLDGQLELDSDGYVVTKPGTTITSVKGVFAAGDVQDKKYRQAVTAAGSGCMAALDAEHYLQEIGSQEGKSD

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAACCCTGCTGCCCCAAACTCTTAAACCTCCTCTATAAAGCCAGAAAACTAATCGGAATCGCCACCATCGGTTCCTCCTCTGCTGCCGCCACCGACGCCATCATCTCCACCACCAAA
TTCTCAACCACCACCTCCGCCGCCATGGACGACCTCCAAACCCTAAAAACTCGCCTTTGCATCATCGGAAGCGGTCCGGCAGCGCACACGGCTGCGATCTACGCGGCGCGTGCGGAAATC
AAGCCGCTCATGTTTGAAGGATGGATGGCGAACGACATCGCCGCCGGCGGACAGCTCACAACAACCACGGACGTGGAGAATTTTCCAGGTTTTCCTGAAGGTATCCTAGGGTTTGAACTC
ATGGAGCGATGTAAGCAACAATCGTTACGGTTCGGTACTCAGATCTATTCTGAAACTGTTAATAAAGTTGATTTTTCATCTGCTCCGTTTAAGTTGTTTACTGATTCGAAAACTGTTGTT
GCTGATTCTGTTATTGTTGCTACTGGTGCCGTTGCGAGACGCTTGACGTTTCCTGGCTCCGGTGAGGGGAAGCTAGGGTTTTGGAACCGAGGTATATCAGCTTGTGCTGTTTGTGATGGT
GCTGCACCGATATTTAGGAATAAACCACTTGCGGTTATCGGTGGAGGTGATTCGGCGATGGAGGAAGCGAATTTTTTGACTAAGTATGGGTCAAAGGTTTATATTATTCACAGGAGGGAT
GAGTTTAGGGCTTCTAAGATTATGCAGCAGAGAGCTTTGAGTAATAGTAAGATTGAGGTTATTTGGAATTCGGCAGTTGTCGAGGCGTATGGTGAAGAAGGGAAGAATGTTTTGGGTGGG
TTGAAAGTGAAGAATGTTGTGAGTGGTGAGGTGTCTGATTTGAAGGTGAATGGTTTGTTTTTCGCGATTGGGCATGAGCCGGCTACAAAGTTTTTGGATGGGCAGTTGGAGCTTGATTCA
GATGGGTATGTTGTGACTAAACCTGGGACGACTATTACTAGTGTGAAGGGTGTGTTTGCTGCTGGTGATGTGCAGGATAAGAAATACAGGCAGGCAGTTACTGCTGCAGGCTCTG
GTATG
TGCATCAACTTTGTTTAATATTTGATGTGAATACGATTGGATTTTTATTTGTTTGCTATAAGTTTTAGACTTTTAGTCATGGTTGGTTGTTATAACTTGATACTTTGCAACTACTGAATG
GCTTTAGTTGAACTTGTATATGTTAAATGTTACTTGGTTATTTGGATTGGGAATAGACGAATAGTGAAGGAACCAGAAATATGTTTCATAGGGGGCACATTGCGATACTTTTTGCCATTT
TTGGAACTAGTTTTCTTTTGAATGCTTGGAATATGTGATAAAAACTATACGCTTACTCTTAATTTGATGCTGGGTTTGGCCCAACACTTGAGCATGCTTGGAATATATTACGATATCTTA
GGACAACTCTTTTTTTAATCTATGCGTCTTTTATGTAAATTAAGATGCACTTCAGTTTTTGTTTACTTTTTGGATGAAATTGGAGTTCCAATTTTGTTAAAGCAAAAGTATAATAATTGG
TTTAACTGTCATAATTTATGCATAACCAAAATCATTACCATCGGACGAAATAAGTATATTAGAAACATGTTATCGTCATAGTTATCAAAAGCAAGGGTACATCTAGGCGCTCAAGTGAGG
CGAGGCTGTTGCTTTTAATTTGAACTCAAAGCAAGTGTCTTTGAAAAGTGCACGGGATATGTGCACCTTTGATGAGGCGGTCTCGTGATATAAGATGTTGACAATTTTTGTTTTTCTTTT
TTGCGTTCTTCTAAATCATGGCTGTCAATAGCGAGTGCTATGACGCGCTACGTAACGTATAGGTCTAGGCTTGCTATTAGGATTGTAGTGATAGATAGCGATAGTAGTGACAATTTTTTA
ATATAAATAGCAATTTAATATAACTATAAAATAGTTGGATTTTAGGTTTTTGTTAAATATACATGTAAAGGGTGGGAGTTGGCTACAAAGTCATTTTTTCCTACAAAGTGTAAAAAGTTA
TAATACACCATAATGTCAACCATAAAACATACTCAAAACCCAACAAATAACATAGTGAAAATTACTAAAACACCATATTTGTGGGTTTTGTGTTGTGTTTTGGATGATAAGGCTTTGATT
ATTGAATGACTAACATTAGTGTGTTTTATGTTGATTATCATGCTGTGTTTTATATTCATTGTTGTACGATTGGGTGTTTGAAGTTTTTAAGAACTCTTAGGGTTTGGATATTGTGTTTTA
GTGATCTTCATTACGTTATTTGTGGGGTGAGTGTGTTTTATGGCTGAAATTGTAGTGTTTTATGATTTTGTACACTTTGTAGGAAAAATGAACTTTGTAGCTGAACCCCACCCTACATAT
AAAATAGCATATATACCAGGGTATTTTGATATAATACACATATAATAGCTGCCCGCTATTTATCGCTATGTAGCATATAGGTACATCTTCGCTATTTGTCGCTATTCGCCACTAACAACT
ATGTTCTTCATAGGCAATAGTTCTGTATTTTCTTTTTTTCTTTTACACCTTTTCATCAATACCAATGTGTTAAAACCCGGTTTTTAAATCATACTGGGTTGGGCTTAAAAATGGTTCAAC
CGGTTGAACCGGGTTGTCCTGGACAGTTCAATCGGGAATCCAGTTAACCCTATAATTCCATAAATACAAATTTATCTAAAATATTATCTAATCTCAATTGGAATTGATGTAATCGGGATA
CCAGTTAACCCTATAATTCCATAAATACAAATTTATCTAAAATATTATCTAATCTCAATTGGAATTGATGTAACTGATGTAACAATTTATAATCTAGACTAATAAACACAATACACTTAA
ATATAAACGTTAACCCGCACAAAAAACTACCCATTTTGACCTGTTATCCAACCCACCTAACAAGCCCGTTTTGCCGTCTCTACCTTAAGACTGATAACAAGTAGTGCCAATCTATGCTTT
AAGAGTACTGACCTTTCATTGTTTTGACTTTTCTTTTGAACAACAAAGAATCTGACGTGTAAACCCACCTTGATGCGCGGGAACCGGATGGAATATGTAAACCCTTACTTCCCGTCAGGT
TCGAACCCGGGATTAAAGCCCCGATTCGTCCCTTCACCTAGATGTTTGTCGAAAATGGCTCAAACAGGAATTGAACCTGCGTATCCACTAGGAAAGGCAGGCCTCTTACCACTGGACCAA
ATTCTGAGGACTCATTGTTTTGACTATTACCTTCGAGGTTTTATATCATGAAACAGTTATTAACCAAAGATTTGTCAAGTGGTTCATTTTTCTTGACTTCTTTTATTATTATTTTCAATG
GTATTTAAGGAATTTGACCATTATTTGGTTTGGGTTTTTATAATCAATACATTTTATAAAAAGAAAGACGCTTCCTGTATTAATAGTGTTTTTTTTTTTTGACAAACTAACATTATAAAT
CTTAATTAACATAATATATATTAACTAAGAAATAATCAAGCAATCTTAACAATGTAAAAAAAACAAAAAAAAAACAAACTTCATATGCTGTGAATTTATTCAATGAATGATTGTCAATTA
AAAAACAAAAGCAAAAACTTATACTTAGGTAGTGTGTAAGAGGTAGCCTGCAGAGCCAACTTGTAGGAGACGCCCAACACTAACAGGCAGTCAAGAACAGTATTCTTCGTATATAGGCAA
GAAAAGAAACAATAGATTATCAACTTAATAGATTTGGGCCGTGGGTTACTGGTTGTTTTTTTTTATTTTTTTTAAAGCCCATGAAACATTTAAATATTAGCTTGTTTTTTCTTCCCTAGT
CTCTCTTCATCACCGTCGGTGAACAACATCCCAGGATCACTGCAGTAACGACACCTACGGCCGCCGGAAAAATAGTACGACCTCTCTTTTTAACTTTAAGTGCTCTGTTAGAGATAACCC
GGGGGGTCAAAACTGTAAAAACAGTTCCGATAGAGTATTCCGGTATACAGTAACTTTGGCCGACCGGAGGGCTAATGGACCCTTCGGACCCCCAGTAAATCCGCCAATGTCCTTGGGGAG
AACAGGCTTGGGGCCCTCCCCCAAAGTCGGCCATGGACGGTCTTCATTAAACGCATTGAGGAGGGCCCTTGGTCTAGGCGAGGCGAGGTATATTCCTCCTCTCTTCTTTCTTCTACGCTA
GCTGCTTAGTCTTTCAGCGCAAATCTTTTTCATTTATCTTGCCAGTCTCTGTAAAGGAGTTATAGGCTTTGTTTTTATTTTTTTTGTGTGGGTTTTCTCTCTTTGTTTGACCCTATTTTA
CATGCTTAGTGTAAAATTGGGTAGAATTAATTTAGCATACAACTAGTTATATATTTTATTCGATTCATTAGTTGGATGCCAAATTTAATAAATATTTATTAGCTGGATGATCAAATGCTA
ATTTTATTCGATTTTTTTATTATATTTGGAGGGTAGGATTAGTTTTGTGTGCCTATTGTTTAACTAAATTTATTGTTAAGTTTTTTTTTTATTATATTTGGAGGGTAGGATTAGTTTTGT
GTGCCTATTGTTTAACTAAATTTATTGTTACGTTTTTATTTATTTCTATGTTTTCGCCTAGGCATCAAACAGGCTCTTTAACCTTAAGTACACCTTATGCCTTTGACCACATAGGTTTAT
GCGAGTTATCTTAATTTTTGTATTTGTAAATTTTGAAAATGTTTTTAAAAGTTTGTTTATTAGTTGGATGATTTTAGTAGCTACATATACTAGGTTTTGTATTATAATGGGGAGAATTAA
TATTTTATGCCATTTTTTTTTATCTCTTACTGTTTAGCTTTTTTTTTCCTCTAGTGTGCGCTTTTTGTGTTTGCGTCTCAAGCGCACTTTTTGACCCTCAAGTGTGTGTTATGCTTTTGA
CTACATAGGTATACAACTAGTTGTATACTTGTATTAAGGTTTATTTAGTTCAAACCATTTGACCTGTTTGACAACCGAAAATTGGCCCATTCATTAATCACCGAGTTAAAGTTGTGTCCT
CTAGTTTATTCGTTGGTAAACCAGACGAAATTGTCAGCTTGGTGTACAAATCATTGTAGGATCCACAGGATCACTGATTATATTTATTATTATGTTTATATTTATTCTGGAAAAGCAATC
AAGTTTCCATAAAGTATTAAAGTATTAACACATATCTGGTGCATGCTTGATTAAAAAGCTATATTTGAGCAACATTCCACAAAAACATTCTCAACCACTACATTCTAGATGGACCAATTA
TTTTAGAAAAAGGATGATCTAAAAGATTTTATGCTTTATAACTACCGCTACGCGTCTACGCTGTTCTCGTTTGATTTTTTTTTTAAAGATGGAATTTATTTTAAAATATTTTATTTGCCA
TGTCATCCTTTACTTGTCTAATGTGTAGCTTATGTGACAGTAATTAAACCATTTAATCTTGTGTGTTGAAGGTTGCATGGCAGCTCTGGATGCAGAACATTACCTGCAAGAAATCGGGTC
TCAGGAAGGGAAGAGTGATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAACCCTGCTGCCCCAAACTCTTAAACCTCCTCTATAAAGCCAGAAAACTAATCGGAATCGCCACCATCGGTTCCTCCTCTGCTGCCGCCACCGACGCCATCATCTCCACCACCAAA
TTCTCAACCACCACCTCCGCCGCCATGGACGACCTCCAAACCCTAAAAACTCGCCTTTGCATCATCGGAAGCGGTCCGGCAGCGCACACGGCTGCGATCTACGCGGCGCGTGCGGAAATC
AAGCCGCTCATGTTTGAAGGATGGATGGCGAACGACATCGCCGCCGGCGGACAGCTCACAACAACCACGGACGTGGAGAATTTTCCAGGTTTTCCTGAAGGTATCCTAGGGTTTGAACTC
ATGGAGCGATGTAAGCAACAATCGTTACGGTTCGGTACTCAGATCTATTCTGAAACTGTTAATAAAGTTGATTTTTCATCTGCTCCGTTTAAGTTGTTTACTGATTCGAAAACTGTTGTT
GCTGATTCTGTTATTGTTGCTACTGGTGCCGTTGCGAGACGCTTGACGTTTCCTGGCTCCGGTGAGGGGAAGCTAGGGTTTTGGAACCGAGGTATATCAGCTTGTGCTGTTTGTGATGGT
GCTGCACCGATATTTAGGAATAAACCACTTGCGGTTATCGGTGGAGGTGATTCGGCGATGGAGGAAGCGAATTTTTTGACTAAGTATGGGTCAAAGGTTTATATTATTCACAGGAGGGAT
GAGTTTAGGGCTTCTAAGATTATGCAGCAGAGAGCTTTGAGTAATAGTAAGATTGAGGTTATTTGGAATTCGGCAGTTGTCGAGGCGTATGGTGAAGAAGGGAAGAATGTTTTGGGTGGG
TTGAAAGTGAAGAATGTTGTGAGTGGTGAGGTGTCTGATTTGAAGGTGAATGGTTTGTTTTTCGCGATTGGGCATGAGCCGGCTACAAAGTTTTTGGATGGGCAGTTGGAGCTTGATTCA
GATGGGTATGTTGTGACTAAACCTGGGACGACTATTACTAGTGTGAAGGGTGTGTTTGCTGCTGGTGATGTGCAGGATAAGAAATACAGGCAGGCAGTTACTGCTGCAGGCTCTG
GTTGC
ATGGCAGCTCTGGATGCAGAACATTACCTGCAAGAAATCGGGTCTCAGGAAGGGAAGAGTGATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATCCATCAA TGTGGGAAAG CATCAATCCT TTTCCACTAA ACATAACCGG CGACGTAATC CTTTTGATTT CCACCTACGG CGAGATTCCC TTTTCCCGCC TAAATATCTT GGCATAGTCA  AACCCCGCGA AAACAAGGCG TGACCGGTTC AGCACTTTTA ACCCAAACCC CCCTATTTCT AGAACTTTCA CCAAATGCAA CCCTGCTGCC CCAAACTCTT AAACCTCCTC TATAAAGCCA  GAAAACTAAT CGGAATCGCC ACCATCGGTT CCTCCTCTGC TGCCGCCACC GACGCCATCA TCTCCACCAC CAAATTCTCA ACCACCACCT CCGCCGCCAT GGACGACCTC CAAACCCTAA  AAACTCGCCT TTGCATCATC GGAAGCGGTC CGGCAGCGCA CACGGCTGCG ATCTACGCGG CGCGTGCGGA AATCAAGCCG CTCATGTTTG AAGGATGGAT GGCGAACGAC ATCGCCGCCG  GCGGACAGCT CACAACAACC ACGGACGTGG AGAATTTTCC AGGTTTTCCT GAAGGTATCC TAGGGTTTGA ACTCATGGAG CGATGTAAGC AACAATCGTT ACGGTTCGGT ACTCAGATCT  ATTCTGAAAC TGTTAATAAA GTTGATTTTT CATCTGCTCC GTTTAAGTTG TTTACTGATT CGAAAACTGT TGTTGCTGAT TCTGTTATTG TTGCTACTGG TGCCGTTGCG AGACGCTTGA  CGTTTCCTGG CTCCGGTGAG GGGAAGCTAG GGTTTTGGAA CCGAGGTATA TCAGCTTGTG CTGTTTGTGA TGGTGCTGCA CCGATATTTA GGAATAAACC ACTTGCGGTT ATCGGTGGAG  GTGATTCGGC GATGGAGGAA GCGAATTTTT TGACTAAGTA TGGGTCAAAG GTTTATATTA TTCACAGGAG GGATGAGTTT AGGGCTTCTA AGATTATGCA GCAGAGAGCT TTGAGTAATA  GTAAGATTGA GGTTATTTGG AATTCGGCAG TTGTCGAGGC GTATGGTGAA GAAGGGAAGA ATGTTTTGGG TGGGTTGAAA GTGAAGAATG TTGTGAGTGG TGAGGTGTCT GATTTGAAGG  TGAATGGTTT GTTTTTCGCG ATTGGGCATG AGCCGGCTAC AAAGTTTTTG GATGGGCAGT TGGAGCTTGA TTCAGATGGG TATGTTGTGA CTAAACCTGG GACGACTATT ACTAGTGTGA  AGGGTGTGTT TGCTGCTGGT GATGTGCAGG ATAAGAAATA CAGGCAGGCA GTTACTGCTG CAGGCTCTGG TTGCATGGCA GCTCTGGATG CAGAACATTA CCTGCAAGAA ATCGGGTCTC  AGGAAGGGAA GAGTGATTGA TTTTAACTCT TCAAGCATTG AAACTATTAT TTAAATTATT GTTGTTTTCA GATTTCGTTT ATTTGCATGT TTGGAAGCGC GAGCAAACAT AAAAGTAGTG  CTACTTGATT CTTAATTTAT TGGCTGGGAT TGCAAGTAAT CTATCTATTT ATCAATATTT GCTTAGTTCT TTAAAACTGC TTGGAAAAAA ACTTTTGTGA GGTAAATATT GATTAATTTT 
GATCGTTTTG TATATGATTT GAAGCTTTAA AAATTTATAA AACATGATGA GATATGTTCA CTC 

Retrieve as FASTA