Entry information : HaGR03 (HanXRQChr11g0342801)
Entry ID 14243
Creation 2016-11-28 (Christophe Dunand)
Last sequence changes 2017-11-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaGR03 (HanXRQChr11g0342801)
Name (synonym) HaGR03 (HanXRQChr11g0342801)
Class Glutathione Reductase    [Orthogroup: GR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaGR03
start..stop
S start..stop
HaGR01 913 0 13..487 19..493
ThasGR01 832 0 1..487 5..489
AtGR01 820 0 1..487 5..495
PpaGR02 682 0 15..486 23..494
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 124413716..124413841 126 N° 2 124414725..124414789 65 N° 3 124414887..124414956 70 N° 4 124415065..124415136 72
N° 5 124415324..124415527 204 N° 6 124415653..124415726 74 N° 7 124416088..124416171 84 N° 8 124416261..124416348 88
N° 9 124416440..124416521 82 N° 10 124417622..124417695 74 N° 11 124417779..124417886 108 N° 12 124418359..124418423 65
N° 13 124418524..124418637 114 N° 14 124419078..124419177 100 N° 15 124419406..124419459 54 N° 16 124419540..124419623 84
join(124413716..124413841,124414725..124414789,124414887..124414956,124415065..1 24415136,124415324..124415527,124415653..124415726,124416088..124416171,12441626 1..124416348,124416440..124416521,124417622..124417695,124417779..124417886,1244 18359..124418423,124418524..124418637,124419078..124419177,124419406..124419459, 124419540..124419623)


exon

Literature and cross-references HaGR03 (HanXRQChr11g0342801)
DNA ref. HanXRQ genome:   HanXRQChr11 (124413716..124419623)
Protein sequence: HaGR03 (HanXRQChr11g0342801)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   487
PWM (Da):   %s   52506.06  
PI (pH):   %s   5.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLIDGDVSNVSDEDQYDFDLFVIGAGSGGVRASRFSAQYGAKVGICELPFHPVSSETVGGVGGTCVIRGCVPKKILVYGAGFGPEIDAREYGWQVNENVDFDWKRLLHKKTEEIVRLNGVYKRLLSNAGVKLFEGEGRIVGPNEVEVIQLDGTKLSYSAKHILISTGSRAHRPDIPGHELAITSDEALSLEELPKRVVILGGGYIAVEFASIWRGMGSTVNLCFRKELPLRGFDDEMRALVARNLEGRGIILHPQTNLTLVKTEDGIKVTTDHGEELMADVVLFATGRVPNTKRLNLQAVGVEVDKIGAVVDEYSRTSVPSIWAIGDVTNRMNLTPVALMEGSMFAKTVFGNEPSKPDHSNVPCAVFCIPPLSVVGLSEEQAIEHATGDILVFTSTFKPMKNTISGRQEKTLMKLIVDADTDKVIGASMCGPDAPEIMGIAIAIKCGATKAQFDNTVGIHPSAAEEFVTMRSATRRIAVAGKP*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGATTGATGGTGATGTGAGTAATGTTAGTGATGAAGATCAGTATGATTTTGATTTGTTTGTGATTGGTGCTGGTAGTGGTGGTGTTAGGGCTTCTAGATTTTCAGCTCAATATGGA
GCTAAG
GTAACACTTTGTTGAGTTTATACGTTACTTGGTTTTAATACGCGTGGTGGCGAGATCACATTGATTCCAAAATGCGCGCACAGTGGCGGACCCAGGATTTATTTTCTCGCTTGG
TTTGGGTGGGGTGGAGGTTTGTGGAATTGGGGGCTTAACTGAACTTTTAAGGGGGTGATGGGGATTTTTTTTTCTAGAAATTACACTTATTTTTTTAACCCCCGGGTGCATAGAGTAGGG
TCCGCCACTATGCGCGCATCACATGATTTAGGGGCTGTTTGGCAACTTCTGAATGGTTAACTGCTGAACCAGTAAGAGGTCTCAATCATTAAGTGCTGAACCAGTAAGAGGTCTGAGCCA
TTAAGAGCCAGTATAATGCTTAACCCTTCAGAGGCAAATGTCTGACCAATTCAGATTAGAGGTCTTAACCATTCAGACTCTGTATAATACTTAATCATTCAGAGGCAAATGTCTGAACCA
TTCAGACATCTGCTCACGAAACAAACAGTCTGAACCATTATGTACTGAACCAGTAAGAGGTCTGAACCATTAAGAGCCTCGTTAAGAGGTAAACAAACAGCCCCTTAGTCTAAACTATTT
GACCATCGTTTGAGCGATGGGTTTGAGTTTTTGAACAAAGCTGATGATGAGAATATCTTATATTTTAGTGTTTCAAAGTTAACAAGTTGAAATATCATCGGTAAATATTTTTTAGTATAT
TCTAATAACGAACGCATCGACACGTGCTTTTGGGATCAAATCGCGTTGGATCGCCACACGCTTTTTTAAAACCAAGACCAAGACATGTTATTCTTATATATGTTTAAGGTGATTTTTTAA
GGATATATGTTTGGTTATTTATCTTTGTTTTACTAAATATTGTTGTAAGGTTGGGATTTGTGAGCTGCCATTTCATCCGGTTAGCTCGGAAACCGTTGGAGGTGTTGGTGGAACGTAAGT
TGTTGGATCTTTGCTTTGGATGTTAGTTTGGGAGAGCACAGTTTGTTAGTGGTGTATGAGTGTGTGTTGTAATGGTTTACATGTGTTGCAGGTGTGTGATTCGTGGGTGTGTTCCGAAGA
AGATTCTGGTTTATGGAGCAGGCTTTGGGCCTGAAATTCAG
GTAATATCGAGTTTCTTCGTTAAACTAGTGAAATCGGGTGGTTTTTGATGTATTGGATCAATGGATTTTTTTATCTAAG
GTTACTCATCTATGTTTCAACTCGTGTAGGATGCACGGGAGTATGGCTGGCAAGTGAATGAGAATGTTGATTTTGATTGGAAAAGGTTACTGCACAAGAAGGTTCGTTGTTAAATGTTTC
TGTTGTGCCATTTTAATTCCTGTTTTTCCCCTTGTCATCAAATTACATTGGTTAAATAAAACCTCCAAAAATCTGGCTTATTTACCTATTCATAAGTAAACGGGTCGCAAATGCCATTTC
TGCTTTTCATCAACGTCATCGTAATCATATCTTTTTTTTTTATTGTAGACTGAGGAAATAGTGAGGCTAAATGGAGTATACAAACGCTTACTTTCAAATGCGGGAGTCAAACTTTTTGAA
GGGGAGGGAAGAATTGTGGGCCCCAACGAAGTGGAAGTGATACAGTTGGATGGCACCAAACTCTCCTACTCTGCAAAACACATACTGATCTCAACCGGTAGCAGGGCACATCGTCCCGAT
ATTCCTGGACAT
GTAAAACCTTTCGATAATTTGAGGAACTCGTTTATTTAATTTAATTTGTCATGCATCCAATGAATCAATAATTTCAATATATAATTTTATGTCTTGCTTTTTTTTATT
TGTGTGGTTCAATTTAGGAGCTAGCTATTACATCTGATGAGGCTTTGAGCTTGGAAGAGTTACCAAAGCGTGTTGTTATACTTGGAGGAGGGTATGTTGACTTTTGACTTTTTATTCATA
GTTATCAATAGTGAATAGCGGACGATAGCGACAAGCTACCTATATGCTACGTAACGACAATGATGAAATTGCGGGTGCTACATGTTTAGCGATACACTAGAAGAAAATTTAAGGAAATAT
TTTATATGTCTATTTTTTCAATTTTTTTTCTTAATTTAAAAAAAATTCAAAAATCTCACTATCTGTTGCTAAATCCTATATAGTGCCATCAATCCTCTTCGCTACGTTATAACGCTCGCT
ATGGGCGCGATTGACATCTATGTTTTCATCTTGGAACGTCTTTAAATTTTTAGTTGAATGTTCACACACGCTGAATCTTTGTATCCGATCAGGTATATTGCCGTGGAGTTCGCTTCAATT
TGGCGTGGGATGGGTTCCACCGTGAATCTATGTTTCAGAAAGGAACTTCCATTGAG
GTTAAAACTTTTTTATTTATATATGAGAATCGACATTTTCAGTAAACCTTTCCAAAGCCGCAAT
TTCAGTGAAATATTAATCATTTCAGAGGTTTTGACGATGAAATGAGAGCGTTGGTTGCAAGAAATCTCGAAGGAAGAGGCATTATTTTGCACCCACAAACAAATTTGACAAAGGTAATTT
TTGTATAATTAATTATTTAATATATTTATACCGATTTACTGTCGTGAATCTTCAGTTGATTAAAGTTATATACGTATGTTTCAGTTGGTTAAAACAGAGGATGGTATTAAAGTTACTACA
GATCATGGTGAAGAACTAATGGCAGATGTCGTACTTTTCGCCACCG
GTAATTTTGGGCCTTCATAAAAGATAGTTGTGTTAATTAAAACTTGAACTTTTTTTTAATTTAGTTGCTTTAAC
ATATTACTTGATGCCTGTGTTTAAAAAAGCGCGCTTAAAGCGAGCATTAAGCGTGAAGCGCTGAAGCGCTGGAAACATCGCTTTTTTTGGTCTGAAGCGTTACATTACGTGAAGCGCTGT
GAAGCGAGCTTTAAGCGCGAAGCGATGATGGTTTGAAGCGACGCTTCAGCCCAATCAGGTCACATTTGGGCCAATTTTTAAGCCCAACAGTCTTTAAATAGGGTTAAATGAGGCCTGTTT
CTTTACCCTAAGTGCTTTTCGACTTTAATTTATGTTTTAACTATGTTTTTTATGTGTTAAGTGTGTTTTTTAATCATGTTTTTGTGTTTGTTATTGGTTAACAAGTAGAATAGGTCATAT
TGATGTGTACAATATATATATATATATATATTTTTTTTTTAATTTTGAGCGCTTCGTATACGTGAAGCTCTCGCTTCGCGCTTGAAGCTTCGCTTAAAGCTTTTGGAACCAAAACGCTTC
AGAGCGCTTCGCGCTTTTTTAAACCAAGCTTGATGCTCCTAATTGTATCCTTAATTATTAAATATAGAGTAAAATGCCATTTTCGTCCTTGAGGTTTGGTCAGTTTTGCGTCTTTCGTCC
AAAGGTTTGTTTTTCCGCATCTAGATCCAAAAGGTTTAAAATCTTACCATTTTCATCCGGCTTATTAACTCCATCCATTTTTCTCCGTTAAGTCAGGAGTATTTCCGTCTTTTTTGTTAA
CTTAAAGGGCAATTCGGTCTTTTTCACTTTATGTACAAGCATTTAGCATAATGTACAAGTATTCAAAAGACCAAATTGGTTGGAGTAAACAAAAAAAGACGAAAATACCCCTGATTTAAC
GTAGAAAAATGGATGGAGTTAACGAGCCGGATGGAAATGGCAAGATTTCAAACCTTTTGGATCCATATGCGAAAAAACAAACCTTTGGACGAAAGTCGCAAAACTGGCCAAACCTCAGGG
ATAAACATGGCATTTTAGTCTTAAATATATTCATCCCAATTCTTACATTTTTTTTGTTGGTCACAGGACGGGTCCCTAATACAAAGAGATTAAATTTGCAAGCTGTGGGTGTTGAAGTCG
ACAAAATAGGAGCAGTGAAG
GTTCCCTTTTTACCTTTTTTCCCTATGTTTTTTTAACGATGCTTGGAATGCAAGTAACAAGAATTTGGATTAAAATTATGCAGGTTGATGAGTATTCTCG
AACCAGTGTGCCTAGCATTTGGGCCATAGGTGACGTTACAAACCGGATGAATCTTACTCCTGTTGCGTTAATGGAAGGATCTATGTTTGCT
GTATGTGATTTCAGCCTTTTTATGAGTTC
TGTTCTTCATTTTTTACTCTGCGTTTACTGATTTTTGTTCAATTTATGCGTCTGCTTTATACTCCGTTGTCCCATAATAAATGCAATTATCTAAAATACAAAAGTAATTATTAATTAGAG
GGAATTTTTGGACTAGAGTTGACGGGATCAATATATTTTAATAATCATTGATGGGCAAATAGGCAATTCTGAAGTAGAGTTGACGTGATCATAGGGGTGGCAAATTCTGACACGATCTGT
AACATGGCATGAAAATGATAAGGTTTTGGGTTGCCGTGTTCGTTTGACCCGTTTAACCCGTTTGATTAAATTTCTGATGAATCCCTAGGATCATTATTGCATTCATTTTGTGGCATCCCG
GAAAGGAAATTTCTGTGACTATTTTGGTACAAATTGATTAGTTCACTTTTTCACGACGTACATTTATTATTTATTGCATACAGAAAACAGTCTTCGGTAACGAACCTAGCAAGCCAGACC
ATAGCAACGTACCTTGTGCCGTTTTCTG
GTAACAGATTATTCAATTCTAACTTTTTTACGGGGGTGAATATGTAAAAATCATTTTTATATATTTTTTTTTAAAATCAAATTTGTATTTTT
CATTTCAGCATACCACCTCTATCCGTTGTTGGACTAAGTGAAGAACAGGCCATAGAGCACGCCACTGGGGACATATTAGTGTTTACGTCAACATTTAAACCAATGAAGAACACCATCTCA
GG
GTATGTAAAATTGTGCCACTTCTTTGTAATCAAGCAAATGGGAATTCGGTTGATAATTTAGAGTGGCATTTTCGACCCATTTATTTGTAAATGGGTTGTGCTGCATTTTAAATGGGTC
AAATGACAAAAACTTAGCTACCATGTTCGAATTATATCGACATTTTTTTTCTCTCTTCAACTCTATAAAAATCATTCTCTTGATTTAAAGATAATTAGGATATAATTTTAGAATCATAGT
GTATTATCTTTTTTTTTTTAAAATGGAGAAAATTGTCTTGATGGTCAACTTTGGTCCATCCATTTTGACCTGAAAGGCTGAAAAGAGTCAATGACCCGTTTTGACACAAGTTTGTTTTGA
TCTGTTTAAGCTTGCCGATCTTGCCACATCTAATGATATGTATTAAGTTTAACTAATAATCTGCACTTTTATATATCCATAGACGACAAGAGAAGACACTCATGAAGCTTATCGTTGATG
CCGACACCGATAAAGTTATCGGAGCCTCGATGTGTGGACCCGATGCACCAGAAATCATGCAG
GTAGTAGACATAATCACTCTTAACCCTTTTAGAAAAATTGCTAATATGTTAAAACCTC
CTATAATTAATAAAAAAAATTAGACTGCTAATGCAATAATATTATATCTACAATCATTTGTGACTCATTAATTATGAATATTAAAAAAAAAAAATTGTACATAATGTGTCTGGTTATTCT
TTTATTGTGTCCTGCAAACACACTTCTAATAATGTTCATATTTTTCTTAGGGCATTGCTATTGCAATCAAATGTGGAGCAACCAAGGCACAATTCGATAACACGGTTAGCTTACGCGGAT
TATATACTTTTTATTTCATAATCTGTTATTTTGGATATAACTGAAAACATTCGATATTTTTCAGGTCGGGATACACCCGTCAGCTGCAGAGGAGTTTGTCACAATGCGGTCAGCTACAAG
GCGTATTGCAGTTGCTGGTAAACCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGATTGATGGTGATGTGAGTAATGTTAGTGATGAAGATCAGTATGATTTTGATTTGTTTGTGATTGGTGCTGGTAGTGGTGGTGTTAGGGCTTCTAGATTTTCAGCTCAATATGGA
GCTAAG
GTTGGGATTTGTGAGCTGCCATTTCATCCGGTTAGCTCGGAAACCGTTGGAGGTGTTGGTGGAACGTGTGTGATTCGTGGGTGTGTTCCGAAGAAGATTCTGGTTTATGGAGCA
GGCTTTGGGCCTGAAATTCAG
GATGCACGGGAGTATGGCTGGCAAGTGAATGAGAATGTTGATTTTGATTGGAAAAGGTTACTGCACAAGAAGACTGAGGAAATAGTGAGGCTAAATGGA
GTATACAAACGCTTACTTTCAAATGCGGGAGTCAAACTTTTTGAAGGGGAGGGAAGAATTGTGGGCCCCAACGAAGTGGAAGTGATACAGTTGGATGGCACCAAACTCTCCTACTCTGCA
AAACACATACTGATCTCAACCGGTAGCAGGGCACATCGTCCCGATATTCCTGGACAT
GAGCTAGCTATTACATCTGATGAGGCTTTGAGCTTGGAAGAGTTACCAAAGCGTGTTGTTATA
CTTGGAGGAGG
GTATATTGCCGTGGAGTTCGCTTCAATTTGGCGTGGGATGGGTTCCACCGTGAATCTATGTTTCAGAAAGGAACTTCCATTGAGAGGTTTTGACGATGAAATGAGAGCG
TTGGTTGCAAGAAATCTCGAAGGAAGAGGCATTATTTTGCACCCACAAACAAATTTGACAAAG
TTGGTTAAAACAGAGGATGGTATTAAAGTTACTACAGATCATGGTGAAGAACTAATG
GCAGATGTCGTACTTTTCGCCACCG
GACGGGTCCCTAATACAAAGAGATTAAATTTGCAAGCTGTGGGTGTTGAAGTCGACAAAATAGGAGCAGTGAAGGTTGATGAGTATTCTCGAACC
AGTGTGCCTAGCATTTGGGCCATAGGTGACGTTACAAACCGGATGAATCTTACTCCTGTTGCGTTAATGGAAGGATCTATGTTTGCT
AAAACAGTCTTCGGTAACGAACCTAGCAAGCCA
GACCATAGCAACGTACCTTGTGCCGTTTTCTG
CATACCACCTCTATCCGTTGTTGGACTAAGTGAAGAACAGGCCATAGAGCACGCCACTGGGGACATATTAGTGTTTACGTCAACATTT
AAACCAATGAAGAACACCATCTCAGG
ACGACAAGAGAAGACACTCATGAAGCTTATCGTTGATGCCGACACCGATAAAGTTATCGGAGCCTCGATGTGTGGACCCGATGCACCAGAAATC
ATGCAG
GGCATTGCTATTGCAATCAAATGTGGAGCAACCAAGGCACAATTCGATAACACGGTCGGGATACACCCGTCAGCTGCAGAGGAGTTTGTCACAATGCGGTCAGCTACAAGGCGT
ATTGCAGTTGCTGGTAAACCGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATAACTGAA ATTAACAAAA ACCTAGCTTC ATAACCGAGT AACCGAAACC AAAGTTGGAT TTGCACATCG CATCTCTTGT CCAACCAAGA GTACAACATC AACTTGCATT CGACCTCCAA  TGATTATTCG AACCTTCTCA AACCCTGCAC TTTAAATAAC GCGTGTTGAG CCCATCATTT CTGCAATCTC GTCTCAAACT CCTCAACAGT CGCAACCTAT CGTGGCAAAT TCTCATTCAA  GCCCTTCCAA TATCGTCTTT AAGAACCCCC ATACTCACGA TCAAGGTCAA CACGTCGTCG TTTCACCTCT AAAAAAGTAT TTTAATCATG TCGAGAAAGA TGCTGATTGA TGGTGATGTG  AGTAATGTTA GTGATGAAGA TCAGTATGAT TTTGATTTGT TTGTGATTGG TGCTGGTAGT GGTGGTGTTA GGGCTTCTAG ATTTTCAGCT CAATATGGAG CTAAGGTTGG GATTTGTGAG  CTGCCATTTC ATCCGGTTAG CTCGGAAACC GTTGGAGGTG TTGGTGGAAC GTGTGTGATT CGTGGGTGTG TTCCGAAGAA GATTCTGGTT TATGGAGCAG GCTTTGGGCC TGAAATTCAG  GATGCACGGG AGTATGGCTG GCAAGTGAAT GAGAATGTTG ATTTTGATTG GAAAAGGTTA CTGCACAAGA AGACTGAGGA AATAGTGAGG CTAAATGGAG TATACAAACG CTTACTTTCA  AATGCGGGAG TCAAACTTTT TGAAGGGGAG GGAAGAATTG TGGGCCCCAA CGAAGTGGAA GTGATACAGT TGGATGGCAC CAAACTCTCC TACTCTGCAA AACACATACT GATCTCAACC  GGTAGCAGGG CACATCGTCC CGATATTCCT GGACATGAGC TAGCTATTAC ATCTGATGAG GCTTTGAGCT TGGAAGAGTT ACCAAAGCGT GTTGTTATAC TTGGAGGAGG GTATATTGCC  GTGGAGTTCG CTTCAATTTG GCGTGGGATG GGTTCCACCG TGAATCTATG TTTCAGAAAG GAACTTCCAT TGAGAGGTTT TGACGATGAA ATGAGAGCGT TGGTTGCAAG AAATCTCGAA  GGAAGAGGCA TTATTTTGCA CCCACAAACA AATTTGACAA AGTTGGTTAA AACAGAGGAT GGTATTAAAG TTACTACAGA TCATGGTGAA GAACTAATGG CAGATGTCGT ACTTTTCGCC  ACCGGACGGG TCCCTAATAC AAAGAGATTA AATTTGCAAG CTGTGGGTGT TGAAGTCGAC AAAATAGGAG CAGTGAAGGT TGATGAGTAT TCTCGAACCA GTGTGCCTAG CATTTGGGCC  ATAGGTGACG TTACAAACCG GATGAATCTT ACTCCTGTTG CGTTAATGGA AGGATCTATG TTTGCTAAAA CAGTCTTCGG TAACGAACCT AGCAAGCCAG ACCATAGCAA CGTACCTTGT  GCCGTTTTCT GCATACCACC TCTATCCGTT GTTGGACTAA GTGAAGAACA GGCCATAGAG CACGCCACTG GGGACATATT AGTGTTTACG TCAACATTTA AACCAATGAA GAACACCATC  TCAGGACGAC AAGAGAAGAC ACTCATGAAG CTTATCGTTG ATGCCGACAC CGATAAAGTT ATCGGAGCCT CGATGTGTGG ACCCGATGCA CCAGAAATCA TGCAGGGCAT TGCTATTGCA  ATCAAATGTG GAGCAACCAA GGCACAATTC GATAACACGG TCGGGATACA CCCGTCAGCT GCAGAGGAGT TTGTCACAAT GCGGTCAGCT ACAAGGCGTA TTGCAGTTGC TGGTAAACCG  TAGACCAACC TCTAAACACG TGTTTTAGTC GGTTCCTCAA AACTCTCGTT GTTAGAAAAC ACATGTGTAA CATTAAGTTT TGATTCATAA GTTGCAACAA TGTTAAATTC ATCATGTTTG  TTTGGTATGT ACTGTGTACT ATATAGCCTT ATGAAATGGA AAACAATAAT GAACGATGAT TGTAATTTAA TTGATTGGGT ATTGGACCGG TACCAAATTA AAATAGAAGT TACAATTTAC 
AAATCTTATC CTTTATAGCA ACTCAAAGTT TGTTCAAA 

Retrieve as FASTA