Entry information : HaGR02 (HanXRQChr10g0281451)
Entry ID 14244
Creation 2016-11-28 (Christophe Dunand)
Last sequence changes 2017-11-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaGR02 (HanXRQChr10g0281451)
Name (synonym) HaGR02 (HanXRQChr10g0281451)
Class Glutathione Reductase    [Orthogroup: GR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaGR02
start..stop
S start..stop
ThasGR02 905 0 6..567 3..564
AtGR02 870 0 71..567 68..565
MpGR01 726 0 71..553 59..549
PpaGR01 685 0 73..565 61..554
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16874792..16875198 407 N° 2 16876622..16876847 226 N° 3 16877665..16877943 279 N° 4 16879437..16879613 177
N° 5 16879713..16879766 54 N° 6 16880447..16880595 149 N° 7 16880679..16880742 64 N° 8 16880825..16880995 171
N° 9 16881077..16881211 135 N° 10 16881883..16881924 42  
join(16874792..16875198,16876622..16876847,16877665..16877943,16879437..16879613 ,16879713..16879766,16880447..16880595,16880679..16880742,16880825..16880995,168 81077..16881211,16881883..16881924)


exon

Literature and cross-references HaGR02 (HanXRQChr10g0281451)
DNA ref. HanXRQ genome:   HanXRQChr10 (16874792..16881924)
Protein sequence: HaGR02 (HanXRQChr10g0281451)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   567
PWM (Da):   %s   60711.13  
PI (pH):   %s   8.34
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATSLSTPKLGTTLSSSTLQTFIFRHKLSILNRSPFLITSQSPSSYSCYTPTLNLSKKALGFLSDSNRKCRRFSTRAESTNGAELRSYDFDLFTIGAGSGGVRASRFAANFGASVAVCELPFATISSETTGGVGGTCVLRGCVPKKLLVYASKYSHEFEESLGFGWSYNSEPTHDWSTLMANKNAELQRLTGIYKNILNNAGVKLIEGRGIVDPHTVDVDGKLYTARNILVSVGGRPFIPDIPGREYVIDSDAALDLPSKPTKIAIVGGGYIALEFAGIFNGLQSDVHVFIRQKQVLRGFDEEVRDFVAEQMSLKGIEFHTEESPQAVIKSADGSLSLKTNKGTVDGFSHVMFATGRKPNTKNLGLETVGVKLDKNGAILVDEYSRTSVPSIWAVGDVTDRMNLTPVALMEGGALAKTLFANEPTKPDFSAVPSAVFSQPPIGQVGVSEQAIEEYGDIDVYTANFRPLKATLSGLPDRVFMKLIVSAKTNQVVGLHMCGEDSAEVVQGFAVAIKAGLTKAQFDSTVGVHPTSAEEFVTMRTPTRKIRNSSSGGKTDSEAKAAAGV*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACATCTCTGAGCACACCAAAGCTCGGCACCACTCTTTCTTCCTCAACTCTCCAAACCTTCATATTCCGTCACAAATTATCAATCCTCAACCGTTCTCCATTCCTTATCACTTCA
CAATCACCATCATCATACAGCTGTTACACACCGACCTTAAATCTCTCCAAAAAAGCCCTAGGGTTTCTCTCCGATAGCAACCGGAAGTGCCGCCGATTCTCCACCAGAGCCGAGTCGACT
AACGGCGCCGAGCTGCGAAGCTATGACTTTGATTTGTTTACTATTGGTGCTGGTAGTGGTGGTGTTAGGGCTTCGAGATTTGCCGCTAATTTTGGGGCGTCTGTTGCTGTTTGTGAGCTT
CCGTTTGCTACTATTTCTTCTGAGACTACTGGAGGTGTTGGTGGAAC
GTAAGTTTATGATTTTGTTTGTTTTATTTTTTTAAAATTTAGTTATAGTTGATGGTTGATGTTGTTGTTACAG
TTACTGTTGGTTGATACTGGATTAGTTAGGTTTATTATTGTAAGTTCCACATAGGTCGGCTTAGGGTTTAGGGTAAGCAATTCGTCCGGTGAAAAACAAAACCGTGAGAATCTGGATTGG
AAACCGTCAGGGACAGACCGCAAAGCGGATAATATTGTGACACGAGTACACTGGGCTCCCTGTGAGGGTTGCGTCGGTTTAGGGGGACCACGAAGCCTTCCTTACAAGGGGGTGTAAATT
CTCTACCTGGACGCGTTTTGCCCGAGCGATCAATTCGTCGGGTGACAAACAAAAGCGTGAATTTCTGGATGGACAACCCATCGGGTGCAAAGCGGACAATATCCTGGAATGCTTTACTTG
GAGTGTTACAGTTACGGTTGGTTGATACTGGATTTATTAGGTTTATTATTGTAAGGTTCACATAGGTAGCTAGGTCGGTTTAGGGTTTACGGTTTAGGGTTTAGGGTAAGCAATTCGTCC
GGTGAAAAACAAAACCGTGAGAATCTGGATTGGCAACCGTCAGGGACAGGCCGCGAAGCGGATAATATTGTGACACGAGTACACTGGGCTCCCTACGAGGGTGGAGATGTAAGCCCCACG
TTGGTTTAGGGGGACAACGAAGCCTTCCTTACAAGGGGGTGTAGATTCTCTACCTGGACGCGTTTTGCCCGAGCGAACAATTCGTCGGGTGACAAACAAAAGCGTGAGTTTCTGGATGGA
CAACCCATCGGGTGCAAAGCGGACAATATCCTGGAATGGTTTACTTGGAGTGTTACGATCATGCTTAAGATAGTTGAAAAAATCGCTAGGTGCTAGTCGGCTAGTGGGGTACCGACTAGC
GATTAATCGGATTGGGATTTTTATGTGAATTTTCAGTTTTTTATATACATACACACACACACATATTTTTATAGGTAAGTATTTTAAGTAGACAGGTTTTAACACCTCATCGACCCATTT
TTTAAGTATACATGATTAATCGCCGGAATCTACATGGTTTGGTTGGAAACTGGCCGGAATTTATAGGTGTTGGCTGGAATATGACCGAAATGACCCATTTTTGGCCGGTCGACTAGGGCC
AATTGGGGCCGACGACTGATTTATGGACCGATTAACAAAAAATTACTTAGTGACCACTAACTAGCGATTAATCGCCAACTAGTCCCGATCTTTACGACACTGATGCTTATAACACTTTAA
TTGAGTGACTATGGTAATTATTGCGTTCTTATTGACAAGCAAAGATTGTGTTGGTGATTTCTGACATTTATGGTGAATTTAACTATATATCTATTTATCCTTAATATGATTTATGCTTTA
AACTAATATACTAATATATTTGGAATGAAGGTGTGTGCTTCGTGGATGTGTACCGAAGAAGCTGCTTGTTTATGCATCTAAATATTCTCATGAATTTGAGGAGAGCCTTGGTTTTGGATG
GTCATACAACTCTGAACCAACACATGATTGGAGCACTTTAATGGCTAATAAGAATGCCGAGTTGCAACGTCTAACTGGAATCTACAAAAACATTTTGAATAATGCAGGCGTCAAATTGAT
CGAAGGACGTGGAAAG
GTTATGTTGTTTATATTTTATTTTTTGCAATATTTTTATATTTGTTTTAGTGATTATGTTTTGAAGAATGATGAAATGGGACGATAATGGTGTTTCTCAAACAT
TTATCTTTGGATAAAACCAAAATTGGTTTTCAGGTTTTTATAATCAACGGTTATAAATTGTAAGCCTGAGTTTAGTATTTTCAGAGTTTTGCTAAAATAGTGAACAAAAAGAACACCTCT
TGACTATTTGACTTTGATAATATTGACTCTGAGATATAAATTTTGGGATTTTCTTTCGTTAATAACCACCTTACTTTCACTGCACCATGTTTTGCATTGGAGCATTAAAAGGTGTCTTTG
TGTGCTGTTCGGGTCATAGTGTAACCATTATTTTTTCTATATGAAATTCTTCATTGTATATAAATCTAACATTTTTGTATAAAAATATATCATTTTTCGATAGCTAGCTACAAAATGATT
CTAACGGTTTACAAGACATCTTAAATGACTCAAATGCAAAAAAGAAAAAAAGAAGTACAATGACTAAAACGGCACGAATGTGAAAGCATGTTGGTTTTTTATGGAAAAAGGAACCTGTTT
TTTTTTTTTTTTTTTTTTAAATTTCTTACTTTATTTCACTGTGTCACTAAAAAAAGCTACATTATTGTGAAATGAATTTTGATTATGTTGTGCAACAAAATATCCCAATCCACTAAATTG
TTTCATTCTCAAAAGAATGCAAATAGAAAATGGTACCTACTAAAACTTCGTTGGCTCCGTTGCTGTTCGAACATACAATTTTTAACGTGTATTTTGTATATTTTTGCAAGCAGATTGTGG
ACCCACACACAGTGGATGTTGATGGGAAACTCTACACTGCAAGAAATATTTTAGTTTCAGTTGGTGGACGCCCATTTATTCCCGATATTCCTGGAAGAGAGTATGTGATAGATTCAGATG
CCGCCCTCGATTTACCATCGAAACCGACAAAAATTGCAATTGTCGGCGGCGGTTATATTGCACTTGAGTTTGCTGGTATTTTCAACGGTTTGCAAAGTGACGTACATGTATTTATTCGTC
AAAAGCAGGTTTTACGTGGGTTTGATGAAGAG
GTGAGAAATTGCAAACAAGAGTTGTATGGTATCTAAAAGAGATTTGACTTTTGAAACTTACATATTTGGCTTTTCATTACAAAGAAAC
CATTATTCTTGCAATGCAAATGAAAAATTACCGTTTGGAAGAAGAGTTTTATTAAACGAAAAATGTCCAGTACAATGCTTCATTGACTAGGGCTGCAAACGAACCGAACGTTCAACGAAC
AGTTTGTGAACCGTTTGGCGGGAAGTTCGTTTGTTCAATAAATGAACAAACACAAACAAGAAATTTCGTTCGTTTAGTTAAATGAACGAACATGAACAGAGGCCACATTTGTTCGTTTAT
GTCGTGAACGTTTGGTAAAATGTTCGTTTGTGTTCGATAGTTCATTAGAGTTTTAAAGTTATATATTTTATTTAAATACTTCAAAATTTCTACTAATAAAATATATTTAATAATTATTAG
TGTATAGTATATTACATACCTTTTTAATATATGCCCGTTTCTGTTCATGAATGCTTGTTTCAGTTGTTTGTGTTTGTTTTTGTTCATTTGTGTTCATGAACATCTGCTTGTGTTCGTTAC
CTAAAATTAACGAACGTACACGAACATGAACATGAACACGTTCGTTTCCTTAATGAACGAACACGAACATAAAATCCCGTTCCGTAAATGTTCATGAACACATTTATTTTCTTAACGAAC
AAACACGAACAATGCCTTGTTTGTGTTCGTTCGGTTCGTTAGTTCTTTCTGCAATTTGTCAGAGGCACCCTTTCTTGCTAACTAGAGTGTTTTTCCCCTAGAGGTAGCAATATAGACGTA
TGCACTTACAAGTGGGTCGATTCGGATTACGTTTTACATCTTGACGGGTCAAACAAGTAAAATGAAAACTTTAGCTTAAAGGAAACAGGTCCAAGGAGTATTTTGAATGGCATAAAACCT
TCAATATCGTTTTGTTTGAAATTCATATCTAGTGTATTTTTTATCAGCTGACAAAATGTATCGGGTCAACCAACCCAAACGAAACCAAAATTTTTCATTTTGACCCGAATCCATTTTGCT
ATCTCTAGATTTATTACAAATGTTTTCTTAAGAAGGGTGGTTGGTAGACATGTACAAAAAAAAAACGTTCGAAAAAAAAACGAAAAAACCCCAATCCGGTTTGTAAAAAAACCGGTTTTT
GAAAAAAAACGGTTTCAAGCGGACTCGGCCCGACGGTTTGGATACCAATTCGTTATCTCGATCTTTGAAACCGGTTAAAAAACCGGTTCGTTTGTAAAAAAAAAAAACAGATTTTTTATC
CGGTTATCCCAAACCGGTTTAAAAACCGATGTTTAAAAACCGAACCGGTTTTTTTGGCCCAAAAAATAAACGATTTTTCCACCACTAGTGGTTGGTCTGTAGTAAAAATCTAAGTACTAC
AGTTCGAAGGTCAGTCTCTCAGTAGTATAATTATCTTGTTTATGGAGCTATTGTGTTAAAAAAAACAACCTTTTGACTTGAATAGGTTAGAGACTTTGTAGCCGAACAAATGTCATTAAA
AGGAATTGAGTTCCACACGGAGGAATCGCCACAAGCAGTTATCAAATCTGCAGATGGGTCGCTGTCCTTAAAGACTAATAAAGGAACAGTTGATGGCTTCTCACATGTTATGTTCGCCAC
AGGACGCAAGCCCAATACAAAG
GTACTTTTTTTCGAGTAAAATACGAATCAAATACTAAGTTGCAAGTATTTACATATCACAACACCTGACATTTCCATTTGTATTTGTTCGACATTGCA
GAATTTGGGATTGGAGACTGTGGGTGTGAAACTGGACAAAAATGGAGCAATACTAGTATGTTTAATTTTTGACCTTTTGTGGTCTGTATATAATAATGGGGTGCTAAACGGGTCGTGTTT
GCGGGTTGGTGGGTTCAACCTGACTCGAACATGAAAATTTTAGACGAACCCGAACACCACCCGGACCTGAAAATTGTGTCATAATATGAACCCGGATATTCTCGCTGCTCAACCCGAACT
TTTTTATTTTTTTATATTTCTCTGCGAATTAATATATTAAAATTAAAATCTACTACAAAAAAACACATATGTATATACTACAATTCACATTTAAACTATAAAATCTTATGTTAGTTTCTC
TTTTTAAGTTATAATTATGGCATAAAATACACACCCAATTTAATTTATGACATAAAACATATTGTAAAAAAATATAATAAAATATAATTGGGTTAAACGGGTCAACCCGCAACGCGACCC
GTTTAGCTAAACGGGTTCGCGGGTTCAACCTGAAACTGACCCGAACCCGTTTAGACTAAACCCAAACCCGCACATTTCGTGTTAGGTTCGTGTCGTGTCAGAAATTCACATCCCTATAGA
ATACATGCTTGGGGAGTTGGGGGTCATTTTTGCTACGAGTGTGATTATACTGGGTGCGTTTGTTTGTTTGTCTATTTGTTTGTTTCGGGGTCATTTTTCATATATTATCATAACTTGTAT
GTCTGATGACTTTAGGTTGATGAATATTCACGTACGTCGGTTCCATCGATTTGGGCAGTTGGAGACGTTACCGATAGAATGAATCTAACCCCTGTTGCTTTGATGGAGGGCGGAGCATTA
GCCAAAACCCTTTTCGCAAACGAACCTACAAAACCCGATTTTAG
GTATTTTTTCCCTTTTAATTTGACCCATTGTTTAAAACCGTGTGCGGCACATGCCTCATTGTTTACTTTTGATTGT
TTTGTAGTGCTGTACCTTCTGCAGTATTCTCTCAGCCACCAATCGGGCAAGTCGGTGTTAGTGAGCAACAGGTGACACTCAAGTAAACGGGTCGAAATTTAACGTATAATATTTATTAGC
AAATACATCTACTAATTCATACATAATTTGCAGGCGATAGAAGAATACGGTGACATCGATGTCTATACAGCAAATTTTAGGCCCTTAAAAGCTACTCTATCGGGCCTTCCAGATAGAGTT
TTCATGAAACTTATAGTGTCTGCAAAAACTAACCAAGTGGTCGGGTTACACATGTGCGGTGAAGATTCAGCAGAAGTTGTTCAG
GTTACTTACATAGTTACATTTTCTATATACATTCTT
GTTTTTCACTATTTTATTTGATGATCTAATTCATGTAAAATACAGGGATTTGCTGTCGCTATTAAAGCTGGGTTGACCAAGGCGCAGTTTGACTCGACCGTTGGTGTTCATCCTACATCA
GCGGAGGAATTTGTCACCATGAGGACACCTACAAGGAAAATTCGAAATTCTTCATCTGGG
GTACGACATTGAACTTCTTTGTAGAGGGTGTTTGGATGTGCATTTTGAAAATGATTATGC
TTTTTTAATAGAAAAGAGTAAACTGCCATTTTGGTCCCTGTGGTTTGGTCACTTTTGCCACTTTAATCCAAAACTCAAACTTTTTGCATCTGGGTCCCTGTGGTTTCAGTTTTATTGCCA
TTTTGGTCCAAAAATGAAATCAGGTCATATTTGCCTTATAAAATCCTGCTATTTTGTCATTTTCCGCAGGGGCAAAATGATCATTTCTCTTTTATAAATAAATACCATATTTTATAAGAC
AAATATGACCTGATTTACCCCTGAGGAAAATGACAAAATTGCAGGATTTTATAAGACAAATATGATCTGATTTCATTTTTGGACCAAAATGGCAATAAAACTGAAACCACAGGGACCCAG
ATGCAAAAAGTTTGAGTTTTGGACTAAAGTGGCAAAAGTGACCAAACCACAGGGACCAAAATGGCAGTTTACTCAATAGAAAATGATTATGTGATATAGATTTATCAGACAAATAATATA
ATGGACCATGGAAAATAGTGTTTGGTATTGTGACAAATATACATCTATCAATCATATGGTTTAAATATATAATTCACAATTTTGTTGTTAATATCCTTTCATATAAATCACCTTCTTAAA
ACTCTATTCAGGGTAAGACGGATTCTGAGGCAAAAGCGGCTGCAGGAGTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACATCTCTGAGCACACCAAAGCTCGGCACCACTCTTTCTTCCTCAACTCTCCAAACCTTCATATTCCGTCACAAATTATCAATCCTCAACCGTTCTCCATTCCTTATCACTTCA
CAATCACCATCATCATACAGCTGTTACACACCGACCTTAAATCTCTCCAAAAAAGCCCTAGGGTTTCTCTCCGATAGCAACCGGAAGTGCCGCCGATTCTCCACCAGAGCCGAGTCGACT
AACGGCGCCGAGCTGCGAAGCTATGACTTTGATTTGTTTACTATTGGTGCTGGTAGTGGTGGTGTTAGGGCTTCGAGATTTGCCGCTAATTTTGGGGCGTCTGTTGCTGTTTGTGAGCTT
CCGTTTGCTACTATTTCTTCTGAGACTACTGGAGGTGTTGGTGGAAC
GTGTGTGCTTCGTGGATGTGTACCGAAGAAGCTGCTTGTTTATGCATCTAAATATTCTCATGAATTTGAGGAG
AGCCTTGGTTTTGGATGGTCATACAACTCTGAACCAACACATGATTGGAGCACTTTAATGGCTAATAAGAATGCCGAGTTGCAACGTCTAACTGGAATCTACAAAAACATTTTGAATAAT
GCAGGCGTCAAATTGATCGAAGGACGTGGAAAG
ATTGTGGACCCACACACAGTGGATGTTGATGGGAAACTCTACACTGCAAGAAATATTTTAGTTTCAGTTGGTGGACGCCCATTTATT
CCCGATATTCCTGGAAGAGAGTATGTGATAGATTCAGATGCCGCCCTCGATTTACCATCGAAACCGACAAAAATTGCAATTGTCGGCGGCGGTTATATTGCACTTGAGTTTGCTGGTATT
TTCAACGGTTTGCAAAGTGACGTACATGTATTTATTCGTCAAAAGCAGGTTTTACGTGGGTTTGATGAAGAG
GTTAGAGACTTTGTAGCCGAACAAATGTCATTAAAAGGAATTGAGTTC
CACACGGAGGAATCGCCACAAGCAGTTATCAAATCTGCAGATGGGTCGCTGTCCTTAAAGACTAATAAAGGAACAGTTGATGGCTTCTCACATGTTATGTTCGCCACAGGACGCAAGCCC
AATACAAAG
AATTTGGGATTGGAGACTGTGGGTGTGAAACTGGACAAAAATGGAGCAATACTAGTTGATGAATATTCACGTACGTCGGTTCCATCGATTTGGGCAGTTGGAGACGTTACC
GATAGAATGAATCTAACCCCTGTTGCTTTGATGGAGGGCGGAGCATTAGCCAAAACCCTTTTCGCAAACGAACCTACAAAACCCGATTTTAG
TGCTGTACCTTCTGCAGTATTCTCTCAG
CCACCAATCGGGCAAGTCGGTGTTAGTGAGCAACAG
GCGATAGAAGAATACGGTGACATCGATGTCTATACAGCAAATTTTAGGCCCTTAAAAGCTACTCTATCGGGCCTTCCAGATAGA
GTTTTCATGAAACTTATAGTGTCTGCAAAAACTAACCAAGTGGTCGGGTTACACATGTGCGGTGAAGATTCAGCAGAAGTTGTTCAG
GGATTTGCTGTCGCTATTAAAGCTGGGTTGACC
AAGGCGCAGTTTGACTCGACCGTTGGTGTTCATCCTACATCAGCGGAGGAATTTGTCACCATGAGGACACCTACAAGGAAAATTCGAAATTCTTCATCTGGG
GGTAAGACGGATTCTGAG
GCAAAAGCGGCTGCAGGAGTTTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AACAAACAAA ATTCGTCATC TGCAAGACTG CAAGCAACCC TTTCCAGAAG AACAACAATG GCGACATCTC TGAGCACACC AAAGCTCGGC ACCACTCTTT CTTCCTCAAC TCTCCAAACC  TTCATATTCC GTCACAAATT ATCAATCCTC AACCGTTCTC CATTCCTTAT CACTTCACAA TCACCATCAT CATACAGCTG TTACACACCG ACCTTAAATC TCTCCAAAAA AGCCCTAGGG  TTTCTCTCCG ATAGCAACCG GAAGTGCCGC CGATTCTCCA CCAGAGCCGA GTCGACTAAC GGCGCCGAGC TGCGAAGCTA TGACTTTGAT TTGTTTACTA TTGGTGCTGG TAGTGGTGGT  GTTAGGGCTT CGAGATTTGC CGCTAATTTT GGGGCGTCTG TTGCTGTTTG TGAGCTTCCG TTTGCTACTA TTTCTTCTGA GACTACTGGA GGTGTTGGTG GAACGTGTGT GCTTCGTGGA  TGTGTACCGA AGAAGCTGCT TGTTTATGCA TCTAAATATT CTCATGAATT TGAGGAGAGC CTTGGTTTTG GATGGTCATA CAACTCTGAA CCAACACATG ATTGGAGCAC TTTAATGGCT  AATAAGAATG CCGAGTTGCA ACGTCTAACT GGAATCTACA AAAACATTTT GAATAATGCA GGCGTCAAAT TGATCGAAGG ACGTGGAAAG ATTGTGGACC CACACACAGT GGATGTTGAT  GGGAAACTCT ACACTGCAAG AAATATTTTA GTTTCAGTTG GTGGACGCCC ATTTATTCCC GATATTCCTG GAAGAGAGTA TGTGATAGAT TCAGATGCCG CCCTCGATTT ACCATCGAAA  CCGACAAAAA TTGCAATTGT CGGCGGCGGT TATATTGCAC TTGAGTTTGC TGGTATTTTC AACGGTTTGC AAAGTGACGT ACATGTATTT ATTCGTCAAA AGCAGGTTTT ACGTGGGTTT  GATGAAGAGG TTAGAGACTT TGTAGCCGAA CAAATGTCAT TAAAAGGAAT TGAGTTCCAC ACGGAGGAAT CGCCACAAGC AGTTATCAAA TCTGCAGATG GGTCGCTGTC CTTAAAGACT  AATAAAGGAA CAGTTGATGG CTTCTCACAT GTTATGTTCG CCACAGGACG CAAGCCCAAT ACAAAGAATT TGGGATTGGA GACTGTGGGT GTGAAACTGG ACAAAAATGG AGCAATACTA  GTTGATGAAT ATTCACGTAC GTCGGTTCCA TCGATTTGGG CAGTTGGAGA CGTTACCGAT AGAATGAATC TAACCCCTGT TGCTTTGATG GAGGGCGGAG CATTAGCCAA AACCCTTTTC  GCAAACGAAC CTACAAAACC CGATTTTAGT GCTGTACCTT CTGCAGTATT CTCTCAGCCA CCAATCGGGC AAGTCGGTGT TAGTGAGCAA CAGGCGATAG AAGAATACGG TGACATCGAT  GTCTATACAG CAAATTTTAG GCCCTTAAAA GCTACTCTAT CGGGCCTTCC AGATAGAGTT TTCATGAAAC TTATAGTGTC TGCAAAAACT AACCAAGTGG TCGGGTTACA CATGTGCGGT  GAAGATTCAG CAGAAGTTGT TCAGGGATTT GCTGTCGCTA TTAAAGCTGG GTTGACCAAG GCGCAGTTTG ACTCGACCGT TGGTGTTCAT CCTACATCAG CGGAGGAATT TGTCACCATG  AGGACACCTA CAAGGAAAAT TCGAAATTCT TCATCTGGGG GTAAGACGGA TTCTGAGGCA AAAGCGGCTG CAGGAGTTTA GGGAGAGACA AGTCAACTAA ATTGCATTGC AATACTTACA  TATAAGGCAC AAGATCCTAC AAGTGAGGCC TTATATGTGA GCTGAGGTGT TTCTTGACAT GAAGTATTAC TCGATAGTCA TGGTCATACT TCAATATCTA TTGATGGATG AAGGTTTTGA  TGTATCAATC ATATTTCCCA TGTATTTATT ACAATTTGTG ATTAAAGATT TCATAAAATT TATTTATCAC TGTAAAAATC TATTTTTGGG ATTAAACTAT TGATAATTTC GCGCCGGCCC  AAAAACACAT CCCAGTTGTA TATGTTTGCA ATCCTGCTGC AAATATGTTT CTGGTTAGGG TTCTACTTGG TGCAATACTG GTTATGCATC TTCAACATGC TTGCGGAAGC AAGTCATGAT 
TCTCGACCCT GATGCTTGTC GGTTTTGTCT GGTAATATTT GAGCAACTCT AGTTGCAATC TTT 

Retrieve as FASTA