Entry information : HaCPF03 (HanXRQChr13g0399791)
Entry ID 14249
Creation 2016-11-28 (Christophe Dunand)
Last sequence changes 2016-11-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaCPF03 (HanXRQChr13g0399791)
Name (synonym) HaCPF03 (HanXRQChr13g0399791)
Class CPF Grx    [Orthogroup: CPF003]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaCPF03
start..stop
S start..stop
ThasCPF04 348 1e-123 1..231 1..234
ThasCPF03 330 2e-116 1..231 1..234
AtCPF04 325 2e-114 9..231 12..235
AtCPF03 320 2e-112 12..231 17..237
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 85171552..85171556 5 N° 2 85171394..85171468 75 N° 3 85171222..85171282 61 N° 4 85169905..85169991 87
N° 5 85169594..85169692 99 N° 6 85169419..85169521 103 N° 7 85168869..85168942 74 N° 8 85168684..85168791 108
N° 9 85168496..85168576 81 N° 10 85168393..85168401 9  
complement(join(85168393..85168401,85168496..85168576,85168684..85168791,8516886 9..85168942,85169419..85169521,85169594..85169692,85169905..85169991,85171222..8 5171282,85171394..85171468,85171552..85171556))


exon

Literature and cross-references HaCPF03 (HanXRQChr13g0399791)
DNA ref. HanXRQ genome:   HanXRQChr13 (85171556..85168393)
Protein sequence: HaCPF03 (HanXRQChr13g0399791)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   233
PWM (Da):   %s   26656.85  
PI (pH):   %s   5.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASVKEVLPPVLDSTSQPPPLFDGTTRLYTNYQCPFAQRVWITRNYGLQDKIKLVPIDLANRPAWYKEKVYPENKVPSLEHNNKIIGESLDLAKYLDAHFDGPALLPNDPAKREFAEELFTYTDTFSKTVLSSFKGDVVKEAGVAFDYLESALQKFDGPFFLGEISVDFVYIPFVERFQIFIQEVFKYDITSGRPKLAAWIEELNKIDAYTVTKADPEHVIQLYKKRFVDQ*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTAAGAACATCTCTCATCTCTCTCTATTTCTATTTCAATTTGAATTTGATTTTGAAGTTAATATTGATGTATTTTTGTGATAGTAGCGTGAAGGAGGTTCTTCCGCCAGTGTTGG
ATTCTACTTCTCAACCGCCTCCTTTGTTCGACGGAACCACTAG
GTATTCGTTCGTGATGTTATCGATTAGTTTAATTGAGTTTAGTGTCACTTTGTTTGTGGTTTAGTGTGATCTGAAGT
TCGTTAATTGGTTTGATTTTGTTTTCAATTGAAGGTTATACACAAACTACCAATGTCCCTTCGCACAGCGTGTTTGGATCACCAGGAATTATAAGGTAAATTTGTGGATCTATTCTATTG
TTTGTAATTTATTTATGATAATTTATAGGTGCACACTTTTTTAGCCCTAAACACTTGATAAAATATTCAATCTGATTTGTTTGGTTGGGTTTTTAAAGATTATAAAATTAGACAAATATC
ATGTGACAGTTTAGTTTATACTTGACCTAAATTCCCTTATTAGTTTAAAGTAAAGTTAAACCTCATGTGACAGTTTAGTTTATACTTGACCTGCGTTGAATGAGCTCTAGGGTATGTCAA
CTATGACTAATTGTTTAATCTACTTGAGCATAGTATCATTCATCACATAATACTAAATGATTGCGATAACAAAAAGAACAAATCCATATCATTAACTTTTTTTTTTTTTTTAATTTATGA
CTCAGTTTAGAAAAAATTATGTTTTTTTATGTATACATCAAAAGTAAAAAACCATCAAATAGGTTTTTTCATATGATTTTAAATTCCTATATATGAACAAATAAACTATTTTTTCATTTA
TTTGTTTAATAAAAGGAGAGATGGATGATAAGTTCATATTCATATGCCTTTCTTTTATATTTAAGTTTTTGATGATTAGAAATATAAATGTTTCATTTTGTTCTACAAATAGATCCTTCC
CTTATACTTGTGTGTCACATCCCTTCCTTCAAATTATGTGAGGGAGACTTTTATTTTATGAAAAGTGGTGGTAGATGGTTGCGAGTAGAGAGGAGAAAAAATGTTACTGTTCATCATCTG
TAAATTTGAGGGGGCACTATTCACTCTTTATAATTTTTTAATATATTTTGAAAGTGGTTGTGAGTGGAAGTGAGAGAAAATGTAATGATAAATGTATTAAAAAGTATTATTTAATTGAAA
ATGAGAGAGAAAAGATAGTGATTTTTAGTGTAATAAGGGTAAAAAAATAGGGGGTTGGATGTGAACAGTGGTGGATCCAAGAACTTCTTTCAGTAGGTTCGTTTTGGTAGATTCTCACTA
GTTTTTTTTCCAAACCGAGTGGGTTCATGTGAACCCATAAAACAAGGCTGGATCTGCCACTGGATGTGAATGCTCTAAGGTAAGGTTGCTTAATGCATAACCAATTTTAAGTAGAGAACT
GCATAACCAAACACTCATACCTATAATGGTTACAAGTAACTTCAAGATCAAGATAGAAAATGTTGGTAGAATTTATATCTCGAAATTAAATTTACATTTTTAAATATCTGGATTTTGATG
TGTAGGGACTACAAGACAAGATTAAGCTTGTTCCTATAGACCTTGCTAATAGACCCGCATGGTACAAGGAGAAAGTTTACCCAGAAAATAAGGTATACATTGTTGCTATTCAGTTTTAAT
TTGGTATTTAATGAGAAAAATATTTCAAGCTCTTTTTTTATACACAAAAACACTTGATATAATAGCTTGCAAGCATTTTCTTTTCTTTTATGATTTTAAAAAGGTTTATTCTAAAAATAA
TAATGTTTAAGTAATTGTTTAAGGTGTATAATGTTGTATCGATGATAATTATATGTTATTTAAGGTGCCATCTCTTGAACACAACAACAAAATCATTGGAGAGAGTCTGGATTTGGCGAA
ATATCTAGATGCTCACTTTGACGGGCCTGCATTACTACCAAAT
GTAAGATTTAACTAACATCTGTCACATTTCCATTTTTACCCCCTCTCAAAGTTGTAACAAGCTTTTGTATAGGACCC
TGCCAAACGAGAGTTTGCTGAGGAGTTATTCACATACACTGACACATTTAGTAAAACAGTGTTATCATCGTTTAAAGGAGATGTTGTGAAAGAAGCTG
GTGTGACTCAAAACTTTTCTTA
TAGCTCCTTTTGTATTTAATTTAGGAGTTGAATGTCATTTTAGTCCCTGTGGTTTGGGCCATTTTGCCAGTTTAGTCCAAAGGTTTCATTTTTTGCCTGTGGGTCCAAAAAGGTTTCACC
GTTGCCATTTTAGTCCACTGGGTTAACTTCATCGATTATTTCTGTTGACGAGAAGGGCAATTGGGTCATTTTGTATGGCCGAATTGCTCTTCTAGTTAACAGAATTACATATAAAATGAC
CCGAATTGTCCTTTTCGTTAACAGAAAAAATGGATGAAGTTAACCCAGTGGACTAAAATGGCAATGGTGAAACCTTTTTGGACCCATAGGCGAAAAATGGAACCTTTGGACTAAACTTGC
AAAATGTTCCAAACCACAGGGACTAAAATGGCATTTAACTCTTAATTTAGCTATCAAATACTAGTTATGAACTTATAATTTGAAATTTGATCAGGTGTTGCTTTTGATTACTTGGAATCA
GCTCTTCAGAAGTTTGACGGTCCGTTTTTCCTCGGAGAGATCAGTTTG
GTGAGTATTCTGTCGAATCGAGCCACTATAAATTTTTACGGGCAGGTTGTTATTGCTAAAAACCTTATGAAT
TGCAGGTGGACTTTGTTTATATTCCTTTTGTAGAAAGGTTTCAAATATTCATACAAGAGGTATTCAAATATGATATTACCTCAGGCAGGCCAAAATTAGCAGCATGGATAGAGGTATCAG
TTTTTTTTTTTTTTGGTTAACTCCATTGGCTTTAATGGTCAAATGATCTTATTCCAACAAGTTTTTAGAAGTATTTAATTTTAACATTAACCTTATACAGGAACTGAACAAAATTGATGC
GTACACAGTGACAAAAGCGGACCCTGAACACGTTATTCAGTTGTACAAAAAGCGTTTTGTG
GTAACTAGCGTTTCGCAGCACATACAAAGTTTCTTTTTATATTTTTTTATGTTGGTTAA
ATAATTAGGTAATGCATCATATATCATTGTTGCAGGATCAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGCGTGAAGGAGGTTCTTCCGCCAGTGTTGGATTCTACTTCTCAACCGCCTCCTTTGTTCGACGGAACCACTAGGTTATACACAAACTACCAATGTCCCTTCGCACAGCGTGTT
TGGATCACCAGGAATTATAAG
GGACTACAAGACAAGATTAAGCTTGTTCCTATAGACCTTGCTAATAGACCCGCATGGTACAAGGAGAAAGTTTACCCAGAAAATAAGGTGCCATCTCTT
GAACACAACAACAAAATCATTGGAGAGAGTCTGGATTTGGCGAAATATCTAGATGCTCACTTTGACGGGCCTGCATTACTACCAAAT
GACCCTGCCAAACGAGAGTTTGCTGAGGAGTTA
TTCACATACACTGACACATTTAGTAAAACAGTGTTATCATCGTTTAAAGGAGATGTTGTGAAAGAAGCTG
GTGTTGCTTTTGATTACTTGGAATCAGCTCTTCAGAAGTTTGACGGTCCG
TTTTTCCTCGGAGAGATCAGTTTG
GTGGACTTTGTTTATATTCCTTTTGTAGAAAGGTTTCAAATATTCATACAAGAGGTATTCAAATATGATATTACCTCAGGCAGGCCAAAATTAGCA
GCATGGATAGAG
GAACTGAACAAAATTGATGCGTACACAGTGACAAAAGCGGACCCTGAACACGTTATTCAGTTGTACAAAAAGCGTTTTGTGGATCAGTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCCTCTATAA ATATAACGAT ATCCCCGTTA CATGTGTCTT ACTCTCGTCT GTCTTCACTT CACCGTTTCT CGAAGCATCT CATAACAATA ATAATGGCTA GCGTGAAGGA GGTTCTTCCG  CCAGTGTTGG ATTCTACTTC TCAACCGCCT CCTTTGTTCG ACGGAACCAC TAGGTTATAC ACAAACTACC AATGTCCCTT CGCACAGCGT GTTTGGATCA CCAGGAATTA TAAGGGACTA  CAAGACAAGA TTAAGCTTGT TCCTATAGAC CTTGCTAATA GACCCGCATG GTACAAGGAG AAAGTTTACC CAGAAAATAA GGTGCCATCT CTTGAACACA ACAACAAAAT CATTGGAGAG  AGTCTGGATT TGGCGAAATA TCTAGATGCT CACTTTGACG GGCCTGCATT ACTACCAAAT GACCCTGCCA AACGAGAGTT TGCTGAGGAG TTATTCACAT ACACTGACAC ATTTAGTAAA  ACAGTGTTAT CATCGTTTAA AGGAGATGTT GTGAAAGAAG CTGGTGTTGC TTTTGATTAC TTGGAATCAG CTCTTCAGAA GTTTGACGGT CCGTTTTTCC TCGGAGAGAT CAGTTTGGTG  GACTTTGTTT ATATTCCTTT TGTAGAAAGG TTTCAAATAT TCATACAAGA GGTATTCAAA TATGATATTA CCTCAGGCAG GCCAAAATTA GCAGCATGGA TAGAGGAACT GAACAAAATT  GATGCGTACA CAGTGACAAA AGCGGACCCT GAACACGTTA TTCAGTTGTA CAAAAAGCGT TTTGTGGATC AGTGAAGTTG ATGAAGTCCT TGGAATCATG ATCCTTTGGG TGAATAAAGT  TGTATGTGTG TCAACTAGTA GTGTTGTGTC TGTCTTATAG ATGGAGAAAC ATATGGTCTT TTGTTGTTAC ATATGATGAT AATAAATGTA TTGCATAATT GCAGACTAGA TGGTGTCTGT  CAAATGAACT GGTGTTGTGT TTCTTATTTT ATGTAGTATA TACAAGTGCA ACAGATGACA AACTAGACAT CCCAAGTATT ATTTTTTGTT TAAAAAGACT ACATACATAA TACAATCTGA 
TTTTTATATC AAA 

Retrieve as FASTA