Entry information : HaDHAR15 (HanXRQChr14g0444501)
Entry ID 14251
Creation 2016-11-28 (Christophe Dunand)
Last sequence changes 2016-11-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaDHAR15 (HanXRQChr14g0444501)
Name (synonym) HaDHAR15 (HanXRQChr14g0444501)
Class Dehydroascorbate Reductase    [Orthogroup: DHAR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaDHAR15
start..stop
S start..stop
ThasDHAR02 360 2e-127 1..254 1..261
AtDHAR03 353 1e-124 1..254 1..258
HaDHAR02 324 2e-113 62..226 22..186
HaDHAR14 312 4e-109 62..236 22..204
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 119405462..119405645 184 N° 2 119402777..119402867 91 N° 3 119402542..119402685 144 N° 4 119402331..119402448 118
N° 5 119402088..119402228 141 N° 6 119401829..119401915 87  
complement(join(119401829..119401915,119402088..119402228,119402331..119402448,1 19402542..119402685,119402777..119402867,119405462..119405645))


exon

Literature and cross-references HaDHAR15 (HanXRQChr14g0444501)
DNA ref. HanXRQ genome:   HanXRQChr14 (119405645..119401829)
Protein sequence: HaDHAR15 (HanXRQChr14g0444501)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   254
PWM (Da):   %s   28112.55  
PI (pH):   %s   7.97
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAIRINSPTTALTLSIKHLTCNPSFPTNCRRFKRNTVAMSSAPLQVCAKSSLTVPNKLGDCPFTQRVLLTLEEKHLPYDLKLVDLGNKPDWFLSISPEGKVPVAKVDDKWIADSDVITQTVEEKFPDPSLVTPPEKASVGSKIFSTYIGFLKSKDANDGTEQALLNELSAFNDYIKEGPFINGKDISAADLSLGPKLYHMEIALGHFKKWSVPDSLPHLKTYMKTVFSLDSFIKTMPLTEDVIEGWRPKVMG*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGGCCATTAGAATAAATTCGCCCACTACGGCGTTGACGCTTTCCATCAAACACCTTACCTGCAACCCTTCTTTCCCCACCAATTGTCGCCGTTTCAAGCGAAATACCGTCGCCATG
TCTTCCGCTCCTCTCCAAGTCTGCGCCAAATCTTCTCTCACTGTCCCTAACAAGCTCGGCGATT
GTAAGTATTTCACGTTTTTATAACAATTTATTTGTTGATTACTTTAATTTGGCTCA
TATTATGTTATGAATAAAATGGTAATCAAAATAACACTATTACATTTTGGCCCTTGTACTTCTAAACATATTAGTAGGATTACGTGTTGTGGATATGATTTAGACTATTTAGTAATGTCT
TTGATTCAATAGTGCGATGTTTGATGCTGTTGTTTGAGATGATGATTGCCTGATCGATTATTTTTGTAATTAGATATATATTTTGCCTTAATAATAACCTAGATATTTGGACATGATGTG
TTTCTGTAATTTGATGATAATCAACCAGTGGCAGAGCCAGATTTTTTTTTACTGGTCGGATTTTTATCACTTTTTTTTTTTTTTTTTGAAAAGTTAACTTCATTAGAAACGCTGACACAC
CTCAAATCGAGGCGGCCGAAACACAACTACATATTTACAAACTTACACCAATCCTCCCACTTAGTGTTCCTATTCTTTGATCTCCTTTTATACCATAAAAATCCCACCGATTTGGTCTCA
GCGATAATATTTTCGATCTTCATAGGATTGTTGTTGAACCTGAGGCCATTTCTTCCCCTCCATAAACTGCAAAACCCTATTCTAACCATCCCTTTCAATACTTCTTTCTGCTGCTCCCTC
AACCCAACATGCTCATGAACCTCGATAAGATCTTTAAAAGAAAATATAAAGAAGTTTGGAATCCTGCACCAGTTACAAATATGCCCCCATAGAGCCGCAACATCATAACATGAGCAGAAT
AAATGTTCCATCGTCTCTTCCACTTCGCCGCAGAACAAGCATGACGGATCTGTCACTTCAATATTTCTTTTTTTTTTTTAAGCCTCCGTCGTCGTCGCAATCCTGTTCAGCTCGGATCTC
CAAATAAAAACGTTACACTTTAAGGGAAGCCATTTGCACCAATCATGAACATGAACCACCGGATCAGACCTGTTTTTGTTTAGGAGCTTTTTCACGGCTGCCACGCTAAAATCTTCATCA
GCTGACCCAATCCAACTCCAACTGTCGCTATCATCTTTCAGCTCAAAATTGTATAACAAGCTGCATAAATCCAATAACTCATTAACCTCTTGACTTGCTGATATGGATCTGCTCCACTGC
CACTCCAAAAACCTACCGTTATCCAGGTGCTTAATCCGATCAGCCACCCTACATTTCTTATCCAGCTCAAGTTTGAAAAGTTCCACTGTTTCAGAAATCTATCTTTCAGTGGCTCGTTAA
TAATCCAAGGATCAAGCCAAAACACCGTATTCAAACCGTTACCTACCGAGCTTTTAAAAAATCTCCTTAATTGGATTCCGTCAACTTGAATTTTCGATTGCAAACCCGCTATGTTGCACC
ACACCCCTCCCATCGATTTTCTTGCCGGAATAAAATCCCATCCCGATCTCGTCACATGAATAGCTTCTCTTACCTTTGTCCAAAGTTTATTTTTGTCGGATAAAAACCTCCATCCCCACT
TTAGCTAGAAGAGACGTGTTAATACTTTTTAGCTTACTGATCCCGAGCCCACTTTAGCTAGAAGAGACGTGTTAACAACTAAAAGCACTAAAATATTGCAATTAATTTCAAACAAGTTTC
ATGATGCAATTAAGTATCAAGTTTCACATCTATTGTCAACATTATTGAAGTAATGAAGTGTAAAATCACTAATTGTATGATAAACGTTCTTGATGTAATTACTTATAAGCTTTGAGTTGT
TTAAGTAAAAGTTATTTGATTTTAAGATAGATATTAAAATTCAAAGATATTATCATAATATCACCACTAAACTAAGTACATGTAAAGAAGATTACTGCATCAACATGCATCGTTCTCAAA
CAAGTGAGCTTTGTATTGCTGCTCGCTTTTGCGTTCTATGAAGTGAACCTCATTTCCAACACAACAACTTGTATTTCCATTTCTACTTAAAATCACACCAGGATCCCTCTTCTTTAACGG
AGTGCTTCCCATCACAGATTCATAATTTTGAAGTATTCATTTTTGTTAATTCGATTCAAGTTTCATATTTGTTTTTTTTTTTTCCTATGAAACAATATTTATGTATTTTGCACTATGATG
AGTTTTATCTTGCAACACGGAAAAAATAAAAACAAACTGTTCCGGTGTCCCACTTTGATTTCCATACAAAGTTAAATACAGTGAGGCATTCCATAAATATCCATTCTGAATAAACCATCA
TTTTTAGGGTAGAAAAGACAATTAAAATGTAGTTGTAATTTGAAGAAGGCAATTAGGTAGAAAAAGGCAATCAAAAATCTCCTTGGGTTCAGTTGAAAATTTAGGATTTAATTAAGATTA
AAACGGCTAGCAAAAAAAGGAACAGAAAGTTAAAACAAAAATCCGCTGGAAGTAGGGATTGAACCCGCCACTAGAGAATGATAAAGGACGGGTATTATACACTTCATATAAATTTCAAAA
ATCATTGGTGTCGCTTGACCCGTTCCAATATATGTAGCTCTGCGCCTCTGCCCCTGATAATCACAATCGTATTACCAAAGGGTACAATTGGTAAAAAAATTTGGGTGCACAGTTATTTTT
ATATATCTGTTGTTTCAGGTCCGTTTACACAGAGAGTTTTGCTGACACTGGAAGAGAAGCATCTTCCTTATGACCTAAAGTTGGTTGATCTCGGTAACAAGCCAGACTGGTAATCATACA
GTATTCCGTTTATAACATGTCGTGTTTTCTTTCAACCTTTCATAATTTGATCTACGCGTGACACTCTTGGTTTTACGTAGGTTTTTAAGTATTAGCCCAGAAGGTAAAGTCCCAGTGGCG
AAGGTTGATGACAAATGGATAGCAGATTCCGATGTTATTACACAGACAGTAGAGGAAAAGTTCCCTGACCCGTCACTGGTGACCCCACCTGAGAAAGCTTCTGT
GTACACTCATGCTCTT
TGTCTCCCCTTTGTTCAGTTTACATTCATTTTTGCAAATTGATGTTGTATAATGGTATTTCTGATTCGTATATCTAGTGGGTCGAAGATCTTTTCGACATATATTGGCTTCTTAAAAAGC
AAAGATGCGAATGATGGAACGGAGCAAGCTTTACTGAATGAACTCTCTGCTTTCAATGATTACATCAAAGAAAAT
GTGGGTTCTGTTCTATCTCTCCACACACGCACATATATATATCAA
ACTGTTTGTTGAATTAGCTTGCTGATTTTAAATTTTGTTTTCGCGTGTTTGTTGAAGGGTCCGTTTATCAACGGAAAGGATATCTCTGCTGCAGACTTGTCGCTAGGTCCGAAGCTGTAC
CATATGGAGATCGCTTTGGGTCATTTTAAGAAGTGGTCAGTCCCGGATTCACTTCCCCATCTGAAAACATACATGAAG
GTACACTTATCTTTGTTGAATTGCATAAAGTTATCTTTTTAT
GAGAGCAGCCTTAATTGTTCTGTTCTTTGATTTTTATCTTTTTCATAACATCTATAACTAACATGATATTATTACATGGTGACTACCCCTTGTAAAACGTTTCACTAATATGGATTTATT
ATGTTTTCAGACTGTGTTCTCATTGGACTCGTTCATCAAAACAATGCCGCTAACAGAAGACGTAATTGAGGGATGGCGGCCAAAGGTCATGGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGGCCATTAGAATAAATTCGCCCACTACGGCGTTGACGCTTTCCATCAAACACCTTACCTGCAACCCTTCTTTCCCCACCAATTGTCGCCGTTTCAAGCGAAATACCGTCGCCATG
TCTTCCGCTCCTCTCCAAGTCTGCGCCAAATCTTCTCTCACTGTCCCTAACAAGCTCGGCGATT
GTCCGTTTACACAGAGAGTTTTGCTGACACTGGAAGAGAAGCATCTTCCTTATGAC
CTAAAGTTGGTTGATCTCGGTAACAAGCCAGACTG
GTTTTTAAGTATTAGCCCAGAAGGTAAAGTCCCAGTGGCGAAGGTTGATGACAAATGGATAGCAGATTCCGATGTTATTACACAG
ACAGTAGAGGAAAAGTTCCCTGACCCGTCACTGGTGACCCCACCTGAGAAAGCTTCTGT
TGGGTCGAAGATCTTTTCGACATATATTGGCTTCTTAAAAAGCAAAGATGCGAATGATGGA
ACGGAGCAAGCTTTACTGAATGAACTCTCTGCTTTCAATGATTACATCAAAGAAAAT
GGTCCGTTTATCAACGGAAAGGATATCTCTGCTGCAGACTTGTCGCTAGGTCCGAAGCTGTAC
CATATGGAGATCGCTTTGGGTCATTTTAAGAAGTGGTCAGTCCCGGATTCACTTCCCCATCTGAAAACATACATGAAG
ACTGTGTTCTCATTGGACTCGTTCATCAAAACAATGCCGCTA
ACAGAAGACGTAATTGAGGGATGGCGGCCAAAGGTCATGGGTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCGAACAATC TTTTAAGGCG GAGAGATTCT ATTCCAGAAG CATCTGGCTC TGGTTTCAGT TTGCACACGT AATCAGCAAC CTCATCTCCA GCAACCACAC TCGCACTAAA ACAATAATAA  TCGTTGACGC AATTAAACTA CAGTATTATT GTGCATTCAC AAATGTCGGC CATTAGAATA AATTCGCCCA CTACGGCGTT GACGCTTTCC ATCAAACACC TTACCTGCAA CCCTTCTTTC  CCCACCAATT GTCGCCGTTT CAAGCGAAAT ACCGTCGCCA TGTCTTCCGC TCCTCTCCAA GTCTGCGCCA AATCTTCTCT CACTGTCCCT AACAAGCTCG GCGATTGTCC GTTTACACAG  AGAGTTTTGC TGACACTGGA AGAGAAGCAT CTTCCTTATG ACCTAAAGTT GGTTGATCTC GGTAACAAGC CAGACTGGTT TTTAAGTATT AGCCCAGAAG GTAAAGTCCC AGTGGCGAAG  GTTGATGACA AATGGATAGC AGATTCCGAT GTTATTACAC AGACAGTAGA GGAAAAGTTC CCTGACCCGT CACTGGTGAC CCCACCTGAG AAAGCTTCTG TTGGGTCGAA GATCTTTTCG  ACATATATTG GCTTCTTAAA AAGCAAAGAT GCGAATGATG GAACGGAGCA AGCTTTACTG AATGAACTCT CTGCTTTCAA TGATTACATC AAAGAAAATG GTCCGTTTAT CAACGGAAAG  GATATCTCTG CTGCAGACTT GTCGCTAGGT CCGAAGCTGT ACCATATGGA GATCGCTTTG GGTCATTTTA AGAAGTGGTC AGTCCCGGAT TCACTTCCCC ATCTGAAAAC ATACATGAAG  ACTGTGTTCT CATTGGACTC GTTCATCAAA ACAATGCCGC TAACAGAAGA CGTAATTGAG GGATGGCGGC CAAAGGTCAT GGGTTAACGC CAATTTATAT CAAGGAGTCA CCCATCAATG  CATCTATGAT AACGTTGTCG AATTTGTTCT CTTTTGGTTT CTGGTTCCTC GCATAGAGTT CGTTGTTCTC TCCTACGTTT CTTTAGATGG CCGAATGCAA CTTATTGCCT ACCATATATA  CATTTTAGTT GAAAACTACT GTAATTGTGT TGTTATGTCG GTTTCTGTAT ATTATCATGA ACAAACTTGT GTTAATATCT TGTCATCATG AATTACAAGT AATGTTATAA CACATCACAT  TCGGGTTCCA AGTCCAAAAT CAACTACATG GTTGACATTG GTTTGGCTTG GTGTTCTTGT CCATTCGATG GCTAAAAATA AACGCATCAT ATGTGTAATC CAACGGGACT AAAGATCGAG  CTTTCATTAT CCTCATATAT TTCTTTGATT CTTCCAATCT CCCTGCTCGG AAAAGACTAA CGATTAACCA TGTAAACACC GATGCACCGG GAGAGAGTTT CCTATATTCC ATTTCATAGT  AAAGCTTAAG AACTCCCTCA ACATCACCTT CTCTTCCATA ACCTGCGATA ATATAAGAAT ATGTATTTGC ATCCGGCATG AACCCTTTAT CTAACAAAAG GGTCAACACG TCATCTGCTC 
GACGAACACT CTCATGTCCA TTTAGCCTCT CAACCACTTC ATTAAAAGCC AAGCAACTCG GAATGAATCC GTTCTGCAA 

Retrieve as FASTA