Entry information : HaMDAR01 (HanXRQChr03g0085961)
Entry ID 14255
Creation 2016-11-28 (Christophe Dunand)
Last sequence changes 2017-11-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaMDAR01 (HanXRQChr03g0085961)
Name (synonym) HaMDAR01 (HanXRQChr03g0085961)
Class Monodhydroascorbate Reductase    [Orthogroup: MDAR003]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaMDAR01
start..stop
S start..stop
AtMDAR01 754 0 1..487 8..491
ThasMDAR01 746 0 1..487 8..491
MpMDAR03 600 0 18..487 16..484
KflMDAR01 522 0 7..481 69..533
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 144833631..144833800 170 N° 2 144833903..144834002 100 N° 3 144834160..144834237 78 N° 4 144834508..144834579 72
N° 5 144835157..144835275 119 N° 6 144835351..144835435 85 N° 7 144835547..144835636 90 N° 8 144835731..144835832 102
N° 9 144835931..144836020 90 N° 10 144836094..144836177 84 N° 11 144836266..144836337 72 N° 12 144836434..144836617 184
N° 13 144836708..144836811 104 N° 14 144836897..144837006 110 N° 15 144837197..144837212 16  
join(144833631..144833800,144833903..144834002,144834160..144834237,144834508..1 44834579,144835157..144835275,144835351..144835435,144835547..144835636,14483573 1..144835832,144835931..144836020,144836094..144836177,144836266..144836337,1448 36434..144836617,144836708..144836811,144836897..144837006,144837197..144837212)


exon

Literature and cross-references HaMDAR01 (HanXRQChr03g0085961)
DNA ref. HanXRQ genome:   HanXRQChr03 (144833631..144837212)
Protein sequence: HaMDAR01 (HanXRQChr03g0085961)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   491
PWM (Da):   %s   52945.23  
PI (pH):   %s   7.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASICSSLSIKSGVSLWCPRSPSLDSHHSSVVTSRSFHQRRNYVVSASSSFANDNREFVIVGGGNAAGYAARTFVEHGMADGKLCIVSKAYAPYERPALTKGYLFPLDKKPARLPGFHTCVGSGGERQTSDWYKEKGIEMIYEDPVTAIDAEKRTLTTNSGKLLKFGSLIIATGCTASRFPEKIGGNLRGVHYIRDVADADSLVSSAKAQKVVVVGGGYIGMEVAAAAVGWNLDTTVIFPETHLLPRLFTPSLAQKYEELYQENGVKFIKGASIKSLEAGPDGNVTGVKLENGSTIEADLVVIGIGAKPAVSPFDKAVSLNTTVGGIEVDGLFRSSLPGIFAVGDVAAFPLKMYNKISRVEHVDHARRSAQHCVKALLTAQTHTYDYLPYFYSRVFEYEGSSRKVWWQFFGDNVGEAIQIGNFDPKIATFWLDSGKLKGVLLESGSPEFQLLPKLAKSQPSIDKVKLQSAASVEEALEIASASILETA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGTATATGTAGTTCACTATCGATCAAGAGTGGGGTTTCCTTATGGTGTCCTCGATCTCCATCTCTTGATTCTCACCATTCTTCAGTTGTTACTTCCAGAAGCTTCCACCAGAGG
AGAAACTACGTCGTTTCTGCATCTTCTTCTTTTGCTAATGATAATCGAGA
GTGAGTTCTTTCTTGTAAAAATTTGATTTTTCTTTTTTGAGTTTTGTCAAAAAAAAAAAAAAAAAAAAAA
AAAAAACTGTTTTGAGATTGGATAGGTTGCAGGTTTGTGATAGTTGGAGGTGGAAATGCTGCTGGATATGCAGCTAGGACTTTCGTCGAACACGGAATGGCTGATGGGAAGCTGTGTATT
GTTTCCAAAGAG
GTAGTCTTAGTTAATTAGGGTTTATGGGTGTTTAAAGGTGGAAACTTGAATAATGAATTCAGATCAAGGATTATAATTACATAATTCTGGTAGTTATTATAGTTTGCT
GTTCTGTTTTTGAGTTGCAAAGTGAAGGATTGTTATGGTATCAATGCAGGCGTATGCTCCGTATGAACGCCCTGCTTTGACGAAAGGCTATTTGTTTCCGTTAGATAAGAAGCCAGCTCG
TTTGCCG
GTAAGCCAGTTTGCTTGATCTGATACCATTGGGGGAGTTATTGTTACTTAAGCAGTTAAGCGTAATACGTTTGTAACTGAAAATGAATCGATATTTGATGAACTAAATTGACA
TTGCGAATGATAATGTTGAGTTTTATTATTGCTTTTGTGTTGCATATGATCGTGTCGATACAATTAGAGATGTGTATCCGTTTTAGGTTGCATTTATTTACATTATGCAAATATGTCATC
TGTATTTGTTTTTTTTTCACCGTTTATATTCTATTAGGGCTTTCACACTTGTGTCGGCTCAGGAGGTGAGAGGCAGACATCTGATTGGTACAAGGAGAAAGGGATTGAGGTATATTATTT
TTTGGACTCTTGTCTTCATGCGGATAAATAGAATTTCTGTTTCAAGCTGGTCATTATTCTGCTATGAATTTGGATCGACTTTATTTAGGGTATGTTTGGCATGGAGCTTTTAGGAGCTTC
AAGCTTTAAGCTTTTAAGAAAAAGCTCCTACTTAATAAAAAGTCTTGTTTGGTTGAAGGAGCTTTAAGCTTTTAGGTTAGGAGCTTGAAGCTTTTGGTTGAACGCTACTACTAGTAGCGT
TTAGAAGGAGCTACAAGCTTTTAGGGAAAAATGACTATTTTAACCTCTCAAAATAAGAAACTTTTTAATGCACCAACTTTCTAAATTTTTAGTTATGTCCATTTTGGTAATTTTATACAT
TTTATTAAAAGCTCCAGCTACTCTACCAAACACCAAATATATCTAAAAAGCTACAGCTACTAGCTACCAGCTACAGCTAACAGCTTTCAGCCACCAGCTACCAGCTTGCAGCTTTCAGCT
ACCAGCCACCAGCTACTTTTGCCAAACATACCCTTAGTTGACTGTAACATTAGAAGATTAAAGTGTAATTCCCGAGCTTACTGCAGATGATTTATGAAGATCCAGTGACAGCAATTGATG
CAGAGAAACGAACATTGACAACAAATTCAGGAAAATTGCTCAAATTTGGATCCCTCATAATTGCCACAGGGTGCACTGCATCTAG
GTAATTCTTTCTGCATTCTTGTAAGTTGTGAATCT
TGTTCGTTTATACGCATCAATGTGATATACGTTTGCTCAGATTTCCAGAGAAAATCGGTGGAAACTTACGTGGTGTTCACTATATTCGAGATGTTGCTGATGCTGATTCATTAGTATCAT
CACTA
GTAAGTGTTCCTTAATATTTATAATAATTTGTCCTATATGGCTATATGCCTATACCTAACTAGTTTTTAGGAACTCTGTACCGATTTATTTTAATGGATACAATTTGCTAGGCTA
AAGCACAAAAAGTAGTAGTGGTTGGTGGTGGTTATATCGGCATGGAAGTTGCCGCTGCTGCTGTTGGATGGAACCTTGACACAACT
GTAAGATTTTACTCACATTCAACATTTTATTTAA
AATAATAATCTTTAATAAATGAGCTTCTAACTTCCGTAGTTTATTTTCCAACAATAATAGGTCATATTTCCCGAAACTCATCTTCTTCCAAGGCTATTCACTCCTTCACTTGCCCAAAAA
TACGAAGAACTTTATCAAGAGAACGGCGTTAAGTTCATCAAG
GTTCTTTTTCTCCCTACGCATTAATACTCTGCACACAACTACACAAGCCCGCACGCACATTCAACATAATCGTGGTTA
ACAATAGTTTTCTTTCACAGGGTGCTTCTATAAAGAGCTTGGAAGCTGGTCCTGATGGAAATGTTACTGGTGTAAAACTTGAAAACGGATCTACAATTGAAGCAGATTTGGTAACTTAAT
TACAACATTTTTGCACACTAACCTTTTAGCATAATTTATACTTTTCTTTTCAATTTTTTCCAGGTCGTTATCGGTATTGGAGCAAAACCGGCTGTCAGTCCTTTTGATAAAGCCGTTAGC
TTAAATACAACCGTTGGTGGGATAGAG
GTTAGCAACTTAGCATAATCAATTTTTTTGTAAATAATCATTTATTCAAGTAAAAAGCCTTTAAAATTCATAATTTATGTATCTTCAGGTTGA
CGGCCTGTTTCGAAGCAGTCTTCCCGGGATTTTCGCTGTTGGTGATGTGGCAGCGTTCCCATTAAAA
GTGTGTTTTTTTATTTATTTTTCTCGAAACTCGTCAGCTACCGCCGTACATTG
TTGGCACTTACATTAACATTATATGATTGTTTGTGACGAACAGATGTACAATAAGATTTCACGTGTAGAACATGTTGATCATGCTCGTCGTTCTGCTCAGCATTGTGTAAAAGCATTACT
AACCGCACAAACTCACACGTATGATTATCTCCCGTATTTCTACTCGAGAGTTTTCGAATATGAAGGTAGTTCAAGGAAAGTATGGTGGCAATTTTTTGGGGATAACG
GTAAGCACATGTC
AAAAAAAACTGTATTTTTCTACGTACCAAGGTGAATTTCCTTAAAAAGGTTATTAACTTAGCACCCGTCTTGAACAGTTGGAGAGGCAATTCAAATCGGGAACTTTGATCCAAAAATTGC
TACATTTTGGTTGGACTCTGGTAAATTAAAGGGTGTGCTTCTTGAAAGCGGATCTCCGGAG
GTATGTGAATTGAAGTTGTTAAGCATTCTTTTAGCTTGATTTATTTCCAGTTACGTTAT
ATTCTGCTTTGTGTGTGTGATTATAGGAGTTCCAACTGCTACCTAAACTAGCGAAGAGTCAACCATCTATCGACAAAGTCAAACTTCAGAGTGCAGCTTCAGTTGAGGAAGCCCTTGAAA
TTGCCAGTGCTTCTAT
GTAGGTTGCAACTCACCTTGTTTATCGTATGCGTTTTGGAACTGCTTATTTATTTATTATAATTTGAAGTCGTAATAACCAGAATTTAAAGAGTGGTTGAATTG
TCGCCTTTGGATGAATCAGTTTGCAACAAGACTTATTTTCATATTACAACTTTCTATTAATCAGGTTTTGTTTGTTTGATTTACAGACTAGAGACTGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGTATATGTAGTTCACTATCGATCAAGAGTGGGGTTTCCTTATGGTGTCCTCGATCTCCATCTCTTGATTCTCACCATTCTTCAGTTGTTACTTCCAGAAGCTTCCACCAGAGG
AGAAACTACGTCGTTTCTGCATCTTCTTCTTTTGCTAATGATAATCGAGA
GTTTGTGATAGTTGGAGGTGGAAATGCTGCTGGATATGCAGCTAGGACTTTCGTCGAACACGGAATGGCT
GATGGGAAGCTGTGTATTGTTTCCAAAGAG
GCGTATGCTCCGTATGAACGCCCTGCTTTGACGAAAGGCTATTTGTTTCCGTTAGATAAGAAGCCAGCTCGTTTGCCGGGCTTTCACACT
TGTGTCGGCTCAGGAGGTGAGAGGCAGACATCTGATTGGTACAAGGAGAAAGGGATTGAG
ATGATTTATGAAGATCCAGTGACAGCAATTGATGCAGAGAAACGAACATTGACAACAAAT
TCAGGAAAATTGCTCAAATTTGGATCCCTCATAATTGCCACAGGGTGCACTGCATCTAG
ATTTCCAGAGAAAATCGGTGGAAACTTACGTGGTGTTCACTATATTCGAGATGTTGCTGAT
GCTGATTCATTAGTATCATCACTA
GCTAAAGCACAAAAAGTAGTAGTGGTTGGTGGTGGTTATATCGGCATGGAAGTTGCCGCTGCTGCTGTTGGATGGAACCTTGACACAACTGTCATA
TTTCCCGAAACTCATCTTCTTCCAAGGCTATTCACTCCTTCACTTGCCCAAAAATACGAAGAACTTTATCAAGAGAACGGCGTTAAGTTCATCAAG
GGTGCTTCTATAAAGAGCTTGGAA
GCTGGTCCTGATGGAAATGTTACTGGTGTAAAACTTGAAAACGGATCTACAATTGAAGCAGATTTG
GTCGTTATCGGTATTGGAGCAAAACCGGCTGTCAGTCCTTTTGATAAAGCCGTT
AGCTTAAATACAACCGTTGGTGGGATAGAG
GTTGACGGCCTGTTTCGAAGCAGTCTTCCCGGGATTTTCGCTGTTGGTGATGTGGCAGCGTTCCCATTAAAAATGTACAATAAGATTTCA
CGTGTAGAACATGTTGATCATGCTCGTCGTTCTGCTCAGCATTGTGTAAAAGCATTACTAACCGCACAAACTCACACGTATGATTATCTCCCGTATTTCTACTCGAGAGTTTTCGAATAT
GAAGGTAGTTCAAGGAAAGTATGGTGGCAATTTTTTGGGGATAACG
TTGGAGAGGCAATTCAAATCGGGAACTTTGATCCAAAAATTGCTACATTTTGGTTGGACTCTGGTAAATTAAAG
GGTGTGCTTCTTGAAAGCGGATCTCCGGAG
GAGTTCCAACTGCTACCTAAACTAGCGAAGAGTCAACCATCTATCGACAAAGTCAAACTTCAGAGTGCAGCTTCAGTTGAGGAAGCCCTT
GAAATTGCCAGTGCTTCTAT
ACTAGAGACTGCATGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCCTATACCA CCCCTCATTA TTATGAGTGT CCTTAAACTG CATCAGAAGG ACTACAAATG CCCTTTCGAT CTGTTTTAGA GCCAATTTTT TATTTATTAT TTTTTTCTAC TATACACACA  CAAATCATGA CCTTCTTCTC CATTATGCAC TCAGGTTTGA CCCCCACTCT TCTCTCTATC TATATATAAA ACTGATCATA AACCCTAATT CTAAAATTCA TAAAATTTCA AAAGCTGCAA  CTGTTAGACG ATCAATGGCG AGTATATGTA GTTCACTATC GATCAAGAGT GGGGTTTCCT TATGGTGTCC TCGATCTCCA TCTCTTGATT CTCACCATTC TTCAGTTGTT ACTTCCAGAA  GCTTCCACCA GAGGAGAAAC TACGTCGTTT CTGCATCTTC TTCTTTTGCT AATGATAATC GAGAGTTTGT GATAGTTGGA GGTGGAAATG CTGCTGGATA TGCAGCTAGG ACTTTCGTCG  AACACGGAAT GGCTGATGGG AAGCTGTGTA TTGTTTCCAA AGAGGCGTAT GCTCCGTATG AACGCCCTGC TTTGACGAAA GGCTATTTGT TTCCGTTAGA TAAGAAGCCA GCTCGTTTGC  CGGGCTTTCA CACTTGTGTC GGCTCAGGAG GTGAGAGGCA GACATCTGAT TGGTACAAGG AGAAAGGGAT TGAGATGATT TATGAAGATC CAGTGACAGC AATTGATGCA GAGAAACGAA  CATTGACAAC AAATTCAGGA AAATTGCTCA AATTTGGATC CCTCATAATT GCCACAGGGT GCACTGCATC TAGATTTCCA GAGAAAATCG GTGGAAACTT ACGTGGTGTT CACTATATTC  GAGATGTTGC TGATGCTGAT TCATTAGTAT CATCACTAGC TAAAGCACAA AAAGTAGTAG TGGTTGGTGG TGGTTATATC GGCATGGAAG TTGCCGCTGC TGCTGTTGGA TGGAACCTTG  ACACAACTGT CATATTTCCC GAAACTCATC TTCTTCCAAG GCTATTCACT CCTTCACTTG CCCAAAAATA CGAAGAACTT TATCAAGAGA ACGGCGTTAA GTTCATCAAG GGTGCTTCTA  TAAAGAGCTT GGAAGCTGGT CCTGATGGAA ATGTTACTGG TGTAAAACTT GAAAACGGAT CTACAATTGA AGCAGATTTG GTCGTTATCG GTATTGGAGC AAAACCGGCT GTCAGTCCTT  TTGATAAAGC CGTTAGCTTA AATACAACCG TTGGTGGGAT AGAGGTTGAC GGCCTGTTTC GAAGCAGTCT TCCCGGGATT TTCGCTGTTG GTGATGTGGC AGCGTTCCCA TTAAAAATGT  ACAATAAGAT TTCACGTGTA GAACATGTTG ATCATGCTCG TCGTTCTGCT CAGCATTGTG TAAAAGCATT ACTAACCGCA CAAACTCACA CGTATGATTA TCTCCCGTAT TTCTACTCGA  GAGTTTTCGA ATATGAAGGT AGTTCAAGGA AAGTATGGTG GCAATTTTTT GGGGATAACG TTGGAGAGGC AATTCAAATC GGGAACTTTG ATCCAAAAAT TGCTACATTT TGGTTGGACT  CTGGTAAATT AAAGGGTGTG CTTCTTGAAA GCGGATCTCC GGAGGAGTTC CAACTGCTAC CTAAACTAGC GAAGAGTCAA CCATCTATCG ACAAAGTCAA ACTTCAGAGT GCAGCTTCAG  TTGAGGAAGC CCTTGAAATT GCCAGTGCTT CTATACTAGA GACTGCATGA TATACATATA GGGAAAAAGG CAGAGGATGT ATTACTATTA TACATTTTCC TCGAGGTACA ACGTGTAATG  CAGAAGGTGC GACATGCGCA TCTTCTCAGT TTCGTATTCC CGACAGCCTA AATAAATAAG AGTCCCTTTT CTGGCCTCTG TTTGACAAGG TCCAAGTTAC CAGTTTAGCC ATTGGCCTAC  TTTCTAGTTG ATTGCCATTG GATTGTTTAA TGGTGGCTGT AAATGAAATC TTGCAATAAA AGTGTTGTTT TACTTGACTT TATTTGTGTA CATCTTATTG TTTTAACATG TATGCTTGTT 
TTAACTACCG AAAAACGCAC GTAGCC 

Retrieve as FASTA