Entry information : CtheKat01
Entry ID 14257
Creation 2016-12-06 (Marcel Zamocky)
Last sequence changes 2017-01-05 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2017-03-03 (Marcel Zamocky)
Peroxidase information: CtheKat01
Name CtheKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Chaetomium
Organism Chaetomium thermophilum    [TaxId: 209285 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CtheKat01
start..stop
S start..stop
CgKat01 1193 0 39..776 1..737
PanKat01 1186 0 46..776 7..736
NcKat01 1171 0 39..776 1..736
CgraKat01 1060 0 39..776 1..742
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68298..68365 68 N° 2 68438..68714 277 N° 3 68765..69193 429 N° 4 69244..70800 1557
join(68298..68365,68438..68714,68765..69193,69244..70800)


exon

Literature and cross-references CtheKat01
Literature REFERENCE #1Amlacher S. et al. (2011) Cell 146:277-289
REFERENCE #2 Zamocky M. et al. (2016) BMC Genomics 17:763
Protein ref. UniProtKB:   G0S8D1
DNA ref. GenBank:   GL988041 (68298..70800)
Protein sequence: CtheKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   776
PWM (Da):   %s   86628.88  
PI (pH):   %s   7.14
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPLATNMQQGTLPRNFLSMNLKDGRYKQKPREKFNRPMAGIMSDTMERAKQAVLGPRESDKLHDLAKVTKDISPDHRLTTDYGVKQTTHDDWLKVASSDKTGPLLLEDPLGREIMRFDHERIPERVVHARGSGAFGKFKLLEPIPELTMAGVLTDTSRETPVFVRFSTVLGSRGSADTVRDVRGFATKFYTKEGNWDIVGNNIPVFFIQDAIKFPDVIHAGKPEPHNEVPQAQSAHNNFWDFQFNHTEATHMFMWTMSDRAIPRSFRMMQGFGVNTFTLINSKGERHFAKFHWTPELGVHSLVWDEALKISGQDPDFHRKDLWEAIANGVYPKWKFGIQVIPEADENKFDFDILDATKVWPEDLVPVRYIGEMELNRNPDEFFTQVEQIAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQISRLGVNFQELPINRPVCPVMNFNRDGALRHTITRGTVNYWPNRYGAVPPATLDEGGYLEYAERVAGIKARMRSAKFKDHFSQAQLFYNSLSPIEKAHLTNALAFELDHCEDPLVYSRMAQRLADIDFSLAKEVHSRIGGDPPSETNRRPNHGKKAPNLSQFDFPPSNPTIASRRVAILVGDGYDHYAFSSAYAALTTAQAVPLVVGTKRSRLRAANDAGSTEPHHHLEGLRSTLVDALFIPGGTESIATLACSGRALHWIREAFGHLKVIGATGEAVSLVQSAIGLPEVKVSGGGEVVECLGVVTVREVTAGSLKEAVDLVKGGDGFMERFFEGVAAHRCWERESQGLSIRIAY*

Retrieve as FASTA  
Remarks complete sequence from genomic (unplaced scaffold, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCCTTGGCCACCAACATGCAACAGGGTACTTTGCCAAGGAACTTCTTGAGTATGAATCTTAAGTAGCTTTTCTACCACAGAAACTAAAGCCATACTACATCCTGTTTACTTGAA
GCTGATTTCTACGAGATCAGAGACGGTCGATATAAGCAAAAGCCAAGAGAAAAGTTCAACAGACCCATGGCCGGAATAATGTCTGACACGATGGAAAGAGCCAAGCAGGCTGTCCTCGGA
CCCCGCGAGAGCGACAAGCTTCATGACTTGGCGAAAGTCACTAAGGACATCTCGCCCGATCACCGATTGACGACAGACTACGGAGTCAAGCAGACCACCCACGATGACTGGCTCAAGGTT
GCCAGCAGCGACAAGACGGGACCTCTTCTCCTGGAGGACCCTCTTGGCCGTGAGAAG
GTGAGATCTCCCTTGAACTATGAACAATTCAGCTTGACTAACACCCTCAGATCATGCGCTTTG
ACCACGAGCGTATTCCCGAAAGAGTCGTTCACGCCCGTGGCAGCGGCGCGTTTGGCAAATTTAAGCTACTGGAGCCCATCCCTGAGCTGACCATGGCGGGCGTGCTCACAGATACGTCGC
GGGAAACGCCCGTTTTCGTGCGCTTCTCCACGGTGCTGGGCAGTCGTGGCAGCGCGGATACTGTTCGTGATGTGAGAGGTTTCGCGACTAAGTTTTACACCAAGGAGGGCAACTGGGACA
TCGTTGGGAACAATATCCCAGTTTTCTTCATCCAGGACGCAATCAAGTTCCCTGACGTCATCCATGCGGGCAAGCCAGAGCCGCATAATGAAGTGCCGCAGGCGCAGTCAGCGCACAATA
ATTTTTGGGATTTTCAGTTTAATCATACAGAGGCGACGCATATGTTTATGTGGACG
GTGAGATTGTCTTCAACTCAACGCTTTTGACCGACCACTGACCTCCTTAGATGAGTGACCGAGC
CATCCCCCGCTCATTCCGCATGATGCAGGGCTTCGGCGTTAATACATTCACTCTAATTAACTCCAAAGGTGAACGACACTTCGCCAAGTTCCACTGGACTCCCGAACTCGGCGTCCACTC
CCTCGTCTGGGACGAAGCGCTCAAAATCTCTGGTCAAGACCCCGACTTCCACCGCAAGGACCTCTGGGAAGCGATTGCCAACGGCGTCTACCCCAAGTGGAAGTTTGGAATCCAAGTGAT
CCCGGAAGCCGACGAAAATAAATTCGACTTCGACATTCTTGACGCAACAAAGGTCTGGCCCGAAGACTTAGTCCCAGTTCGCTACATCGGCGAGATGGAGCTCAACCGCAACCCTGACGA
GTTCTTCACGCAAGTCGAGCAAATCGCCTTCTGCACAAGTCACGTCGTTCCCGGCATAGGCTTCTCGGACGACCCACTCCTTCAGGGCCGTAACTTCAGCTACTTCGACACACAGATCTC
CCGGCTGGGCGTCAACTTCCAGGAGCTGCCTATTAACAGGCCGGTGTGTCCAGTCATGAACTTTAATCGTGACGGTGCCCTCCGCCACACCATCACCCGGGGAACGGTGAACTATTGGCC
CAACCGCTACGGTGCCGTACCTCCTGCAACCCTCGACGAGGGCGGGTATCTGGAGTATGCCGAGCGCGTGGCAGGCATCAAAGCCCGTATGCGCAGCGCTAAGTTCAAAGACCACTTCTC
TCAGGCCCAGCTCTTCTACAACTCATTATCTCCCATCGAAAAAGCTCACTTAACCAACGCTCTGGCCTTCGAACTTGACCATTGCGAGGATCCTCTGGTGTACAGCCGGATGGCGCAGCG
CTTAGCGGACATCGATTTCTCTCTCGCAAAGGAAGTCCACTCGAGAATCGGAGGAGATCCCCCATCTGAAACAAATCGCCGCCCCAACCACGGAAAGAAGGCACCAAATTTAAGCCAGTT
CGATTTTCCCCCTTCCAACCCGACCATCGCTTCCCGCAGGGTCGCGATCTTGGTTGGAGACGGATACGATCACTACGCCTTTTCTTCAGCATATGCAGCCTTAACAACGGCACAAGCCGT
CCCCCTCGTTGTCGGCACGAAACGTTCCCGCCTCCGCGCCGCTAACGATGCCGGCTCTACCGAACCCCATCACCACCTCGAAGGATTACGCTCGACGCTAGTCGACGCGCTCTTCATCCC
CGGCGGGACCGAGTCCATCGCGACCCTAGCCTGCTCAGGTAGGGCATTGCACTGGATCCGGGAGGCATTTGGGCATTTGAAGGTGATTGGGGCTACGGGGGAGGCAGTCTCGTTGGTGCA
GAGCGCGATTGGGCTGCCGGAGGTGAAGGTTTCGGGAGGAGGGGAGGTAGTGGAATGTTTGGGGGTTGTTACGGTTAGAGAGGTGACGGCAGGGAGTTTGAAGGAGGCTGTAGATTTGGT
GAAGGGAGGGGATGGGTTTATGGAGAGGTTCTTTGAGGGGGTTGCAGCGCATAGGTGCTGGGAGAGGGAGAGTCAAGGGCTTAGCATAAGGATTGCGTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCCTTGGCCACCAACATGCAACAGGGTACTTTGCCAAGGAACTTCTTGAGTATGAATCTTAAAGACGGTCGATATAAGCAAAAGCCAAGAGAAAAGTTCAACAGACCCATGGCC
GGAATAATGTCTGACACGATGGAAAGAGCCAAGCAGGCTGTCCTCGGACCCCGCGAGAGCGACAAGCTTCATGACTTGGCGAAAGTCACTAAGGACATCTCGCCCGATCACCGATTGACG
ACAGACTACGGAGTCAAGCAGACCACCCACGATGACTGGCTCAAGGTTGCCAGCAGCGACAAGACGGGACCTCTTCTCCTGGAGGACCCTCTTGGCCGTGAGAAG
ATCATGCGCTTTGAC
CACGAGCGTATTCCCGAAAGAGTCGTTCACGCCCGTGGCAGCGGCGCGTTTGGCAAATTTAAGCTACTGGAGCCCATCCCTGAGCTGACCATGGCGGGCGTGCTCACAGATACGTCGCGG
GAAACGCCCGTTTTCGTGCGCTTCTCCACGGTGCTGGGCAGTCGTGGCAGCGCGGATACTGTTCGTGATGTGAGAGGTTTCGCGACTAAGTTTTACACCAAGGAGGGCAACTGGGACATC
GTTGGGAACAATATCCCAGTTTTCTTCATCCAGGACGCAATCAAGTTCCCTGACGTCATCCATGCGGGCAAGCCAGAGCCGCATAATGAAGTGCCGCAGGCGCAGTCAGCGCACAATAAT
TTTTGGGATTTTCAGTTTAATCATACAGAGGCGACGCATATGTTTATGTGGACG
ATGAGTGACCGAGCCATCCCCCGCTCATTCCGCATGATGCAGGGCTTCGGCGTTAATACATTCACT
CTAATTAACTCCAAAGGTGAACGACACTTCGCCAAGTTCCACTGGACTCCCGAACTCGGCGTCCACTCCCTCGTCTGGGACGAAGCGCTCAAAATCTCTGGTCAAGACCCCGACTTCCAC
CGCAAGGACCTCTGGGAAGCGATTGCCAACGGCGTCTACCCCAAGTGGAAGTTTGGAATCCAAGTGATCCCGGAAGCCGACGAAAATAAATTCGACTTCGACATTCTTGACGCAACAAAG
GTCTGGCCCGAAGACTTAGTCCCAGTTCGCTACATCGGCGAGATGGAGCTCAACCGCAACCCTGACGAGTTCTTCACGCAAGTCGAGCAAATCGCCTTCTGCACAAGTCACGTCGTTCCC
GGCATAGGCTTCTCGGACGACCCACTCCTTCAGGGCCGTAACTTCAGCTACTTCGACACACAGATCTCCCGGCTGGGCGTCAACTTCCAGGAGCTGCCTATTAACAGGCCGGTGTGTCCA
GTCATGAACTTTAATCGTGACGGTGCCCTCCGCCACACCATCACCCGGGGAACGGTGAACTATTGGCCCAACCGCTACGGTGCCGTACCTCCTGCAACCCTCGACGAGGGCGGGTATCTG
GAGTATGCCGAGCGCGTGGCAGGCATCAAAGCCCGTATGCGCAGCGCTAAGTTCAAAGACCACTTCTCTCAGGCCCAGCTCTTCTACAACTCATTATCTCCCATCGAAAAAGCTCACTTA
ACCAACGCTCTGGCCTTCGAACTTGACCATTGCGAGGATCCTCTGGTGTACAGCCGGATGGCGCAGCGCTTAGCGGACATCGATTTCTCTCTCGCAAAGGAAGTCCACTCGAGAATCGGA
GGAGATCCCCCATCTGAAACAAATCGCCGCCCCAACCACGGAAAGAAGGCACCAAATTTAAGCCAGTTCGATTTTCCCCCTTCCAACCCGACCATCGCTTCCCGCAGGGTCGCGATCTTG
GTTGGAGACGGATACGATCACTACGCCTTTTCTTCAGCATATGCAGCCTTAACAACGGCACAAGCCGTCCCCCTCGTTGTCGGCACGAAACGTTCCCGCCTCCGCGCCGCTAACGATGCC
GGCTCTACCGAACCCCATCACCACCTCGAAGGATTACGCTCGACGCTAGTCGACGCGCTCTTCATCCCCGGCGGGACCGAGTCCATCGCGACCCTAGCCTGCTCAGGTAGGGCATTGCAC
TGGATCCGGGAGGCATTTGGGCATTTGAAGGTGATTGGGGCTACGGGGGAGGCAGTCTCGTTGGTGCAGAGCGCGATTGGGCTGCCGGAGGTGAAGGTTTCGGGAGGAGGGGAGGTAGTG
GAATGTTTGGGGGTTGTTACGGTTAGAGAGGTGACGGCAGGGAGTTTGAAGGAGGCTGTAGATTTGGTGAAGGGAGGGGATGGGTTTATGGAGAGGTTCTTTGAGGGGGTTGCAGCGCAT
AGGTGCTGGGAGAGGGAGAGTCAAGGGCTTAGCATAAGGATTGCGTACTAG

Retrieve as FASTA