Entry information : HaAPR01HanXRQChr05g0129431
Entry ID 14479
Creation 2017-11-03 (Christophe Dunand)
Last sequence changes 2017-11-03 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaAPR01HanXRQChr05g0129431
Name HaAPR01HanXRQChr05g0129431
Class Thioredoxin Type APR    [Orthogroup: APR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaAPR01
start..stop
S start..stop
HaAPR02 848 0 1..463 1..461
HaAPR03 757 0 1..463 42..507
AtAPR03 718 0 33..463 32..458
ThasAPR03 715 0 14..463 20..466
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2208479..2208554 76 N° 2 2208214..2208378 165 N° 3 2207789..2207918 130 N° 4 2206902..2207691 790
N° 5 2206582..2206812 231  
complement(join(2206582..2206812,2206902..2207691,2207789..2207918,2208214..2208 378,2208479..2208554))


exon

Literature and cross-references HaAPR01HanXRQChr05g0129431
DNA ref. HanXRQ genome:   HanXRQChr05 (2208554..2206582)
Protein sequence: HaAPR01HanXRQChr05g0129431
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   463
PWM (Da):   %s   51306.89  
PI (pH):   %s   6.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALAFTASTSASIAFSSSNSRTEQQGIQFSASNLQTLDRSFPSPAALNLSRKRSEAVKALNAEPKRNDSIVPSAATVFAPDVVDKSIEVEDIEKLAQDLEKASPLEIMDKALEKYGNDIAIAFSGAEDVALIEYAHLTGRPFRVFSLDTGRLNPETYKFFDTVEKHYGIRIEYMFPDAVEVQALVRTKGLFSFYEDGHQECCRVRKVRPLRRALKGLRAWITGQRKDQSPGTRSEVPVVQVDPVFEGMDGGSGSLVKWNPVANVAGNDIWNFLRTMEVPVNTLHAQGYISIGCEPCTRPVLPGQHEREGRWWWEDAKAKECGLHKGNLKEENVNGNGSVNGNASSDIFESQNIVNLSRPGIENLLKMEDRKDGWMVVLYAPWCPFCAMEASYEELADKLAGSGVKVGKFRADGEQKTFAKQELQLGSFPTILFFPKHSSRPIKYASEKRDVDSLMAFINALR*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGGCTTTTACTGCTTCTACTTCTGCTTCAATTGCATTTTCCTCTTCTAATTCTCGTACAGAACAACAAGGTATATTCATTGATTTTACCCTTGTATTTACTGTTTCTGTTTCC
TAATTTTTTGATAGTGTTTTGAATTGCAATGTTTCTTATTTAATTTATGATTGCAGGGATTCAGTTTAGTGCAAGCAATTTGCAAACTTTAGATCGATCTTTTCCGTCACCGGCGGCTCT
TAATTTATCCCGGAAACGATCTGAGGCTGTGAAGGCTTTGAATGCTGAACCCAAGAGGAATGATTCTATCGTTCCTTCTGCTGCCACTGTGTTTGCTCCCG
GTATGATTATTATTACTTT
TCTAGGGTTTATAAATCAACCATGCAATCAGGATCAATTAGGGGCATTTTAGTCGTTTTATAGGATTAATTTATTTTATTATGCCCTTTTATATAATCCAGGGTTCATGTTAATCAATAA
TCATAGTACTAGGTTAAGGTTTACTCACTGGTGAGAAAATTTTGACTTTTTAAGGTCAAGTATTTGAAAATTAAAATTGCTAAAATGTTACTGGTTTTTTTACAAGTAACTTAGGGTGTG
TGTCATAATTGCTTATTGTGTTGGTTAATTATACAGATGTAGTGGACAAATCAATAGAGGTTGAGGACATTGAGAAATTGGCTCAGGATCTTGAGAAGGCTTCCCCACTTGAAATCATGG
ATAAAGCCCTTGAAAAATATGGGAATGATATTGCTATAGCTTTCAG
GTAATCCAACACTACAACTTGTTTCTGCACGATTTAAAACTAGCTTATGATTGTTGTAATACAATCTTAACATC
CCAAAATTGTGCCTTGATTCCAGTGGTGCAGAAGATGTTGCTTTGATAGAGTATGCTCACTTGACCGGACGCCCGTTCAGGGTTTTTAGCCTTGACACCGGGAGGCTAAACCCGGAAACG
TACAAATTCTTTGATACCGTTGAGAAACACTATGGCATCCGGATTGAGTACATGTTCCCGGATGCTGTGGAAGTACAAGCCTTGGTTAGAACCAAGGGTCTTTTCTCATTTTATGAAGAC
GGTCATCAGGAATGTTGCCGTGTGCGAAAGGTGCGACCTTTGAGGCGGGCTTTGAAGGGTTTGCGGGCTTGGATCACGGGTCAGAGAAAAGACCAGTCTCCAGGGACTAGGTCCGAAGTT
CCAGTGGTTCAGGTGGATCCGGTTTTTGAAGGGATGGATGGTGGGTCGGGAAGCTTGGTGAAGTGGAACCCTGTTGCTAATGTAGCTGGTAACGATATATGGAACTTCCTCCGAACCATG
GAGGTACCGGTTAACACGCTGCATGCTCAGGGGTACATCTCAATAGGGTGCGAGCCGTGCACGAGGCCGGTCTTGCCCGGTCAACACGAGAGGGAAGGAAGGTGGTGGTGGGAGGATGCC
AAAGCTAAAGAATGCGGGCTGCATAAAGGAAACCTTAAAGAGGAAAACGTAAATGGGAATGGTTCGGTGAATGGTAATGCGAGTTCTGATATCTTTGAGAGCCAAAACATTGTGAACTTG
AGCCGGCCTGGTATTGAGAATCTTCTGAAGATGGAAGACCGAAAAGACGGTTGGATGGTTGTTCTTTATGCACCCTGGTGCCCCTTCTGTCAG
GTAATGAACACGATCATGGTTATACTA
TATGCATCGATTTAATGTACTTTACACATTGTCATAGTGTTAAACGTTCATTGTGTTTGCAGGCAATGGAAGCATCGTATGAGGAACTGGCTGATAAGTTAGCTGGAAGTGGTGTAAAGG
TTGGGAAATTTAGAGCCGACGGTGAGCAGAAGACGTTCGCGAAACAAGAATTGCAGCTTGGGAGCTTCCCGACGATCCTTTTCTTCCCGAAGCACTCGTCAAGGCCTATTAAGTATGCGT
CCGAGAAGAGAGATGTTGACTCTTTGATGGCTTTCATTAACGCCCTTAGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGGCTTTTACTGCTTCTACTTCTGCTTCAATTGCATTTTCCTCTTCTAATTCTCGTACAGAACAACAAGGGATTCAGTTTAGTGCAAGCAATTTGCAAACTTTAGATCGATCT
TTTCCGTCACCGGCGGCTCTTAATTTATCCCGGAAACGATCTGAGGCTGTGAAGGCTTTGAATGCTGAACCCAAGAGGAATGATTCTATCGTTCCTTCTGCTGCCACTGTGTTTGCTCCC
G
ATGTAGTGGACAAATCAATAGAGGTTGAGGACATTGAGAAATTGGCTCAGGATCTTGAGAAGGCTTCCCCACTTGAAATCATGGATAAAGCCCTTGAAAAATATGGGAATGATATTGCT
ATAGCTTTCAG
TGGTGCAGAAGATGTTGCTTTGATAGAGTATGCTCACTTGACCGGACGCCCGTTCAGGGTTTTTAGCCTTGACACCGGGAGGCTAAACCCGGAAACGTACAAATTCTTT
GATACCGTTGAGAAACACTATGGCATCCGGATTGAGTACATGTTCCCGGATGCTGTGGAAGTACAAGCCTTGGTTAGAACCAAGGGTCTTTTCTCATTTTATGAAGACGGTCATCAGGAA
TGTTGCCGTGTGCGAAAGGTGCGACCTTTGAGGCGGGCTTTGAAGGGTTTGCGGGCTTGGATCACGGGTCAGAGAAAAGACCAGTCTCCAGGGACTAGGTCCGAAGTTCCAGTGGTTCAG
GTGGATCCGGTTTTTGAAGGGATGGATGGTGGGTCGGGAAGCTTGGTGAAGTGGAACCCTGTTGCTAATGTAGCTGGTAACGATATATGGAACTTCCTCCGAACCATGGAGGTACCGGTT
AACACGCTGCATGCTCAGGGGTACATCTCAATAGGGTGCGAGCCGTGCACGAGGCCGGTCTTGCCCGGTCAACACGAGAGGGAAGGAAGGTGGTGGTGGGAGGATGCCAAAGCTAAAGAA
TGCGGGCTGCATAAAGGAAACCTTAAAGAGGAAAACGTAAATGGGAATGGTTCGGTGAATGGTAATGCGAGTTCTGATATCTTTGAGAGCCAAAACATTGTGAACTTGAGCCGGCCTGGT
ATTGAGAATCTTCTGAAGATGGAAGACCGAAAAGACGGTTGGATGGTTGTTCTTTATGCACCCTGGTGCCCCTTCTGTCAG
GCAATGGAAGCATCGTATGAGGAACTGGCTGATAAGTTA
GCTGGAAGTGGTGTAAAGGTTGGGAAATTTAGAGCCGACGGTGAGCAGAAGACGTTCGCGAAACAAGAATTGCAGCTTGGGAGCTTCCCGACGATCCTTTTCTTCCCGAAGCACTCGTCA
AGGCCTATTAAGTATGCGTCCGAGAAGAGAGATGTTGACTCTTTGATGGCTTTCATTAACGCCCTTAGATGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCATCCTTTT TCTTCTCATA AATTCCCCCA ACTTCCTTCC TTCCATCCTC AAATTCACAA TTCTCAATTT GTTTACATCT CCTTTCAACC TTCATCATCA ATGGCGTTGG CTTTTACTGC  TTCTACTTCT GCTTCAATTG CATTTTCCTC TTCTAATTCT CGTACAGAAC AACAAGGGAT TCAGTTTAGT GCAAGCAATT TGCAAACTTT AGATCGATCT TTTCCGTCAC CGGCGGCTCT  TAATTTATCC CGGAAACGAT CTGAGGCTGT GAAGGCTTTG AATGCTGAAC CCAAGAGGAA TGATTCTATC GTTCCTTCTG CTGCCACTGT GTTTGCTCCC GATGTAGTGG ACAAATCAAT  AGAGGTTGAG GACATTGAGA AATTGGCTCA GGATCTTGAG AAGGCTTCCC CACTTGAAAT CATGGATAAA GCCCTTGAAA AATATGGGAA TGATATTGCT ATAGCTTTCA GTGGTGCAGA  AGATGTTGCT TTGATAGAGT ATGCTCACTT GACCGGACGC CCGTTCAGGG TTTTTAGCCT TGACACCGGG AGGCTAAACC CGGAAACGTA CAAATTCTTT GATACCGTTG AGAAACACTA  TGGCATCCGG ATTGAGTACA TGTTCCCGGA TGCTGTGGAA GTACAAGCCT TGGTTAGAAC CAAGGGTCTT TTCTCATTTT ATGAAGACGG TCATCAGGAA TGTTGCCGTG TGCGAAAGGT  GCGACCTTTG AGGCGGGCTT TGAAGGGTTT GCGGGCTTGG ATCACGGGTC AGAGAAAAGA CCAGTCTCCA GGGACTAGGT CCGAAGTTCC AGTGGTTCAG GTGGATCCGG TTTTTGAAGG  GATGGATGGT GGGTCGGGAA GCTTGGTGAA GTGGAACCCT GTTGCTAATG TAGCTGGTAA CGATATATGG AACTTCCTCC GAACCATGGA GGTACCGGTT AACACGCTGC ATGCTCAGGG  GTACATCTCA ATAGGGTGCG AGCCGTGCAC GAGGCCGGTC TTGCCCGGTC AACACGAGAG GGAAGGAAGG TGGTGGTGGG AGGATGCCAA AGCTAAAGAA TGCGGGCTGC ATAAAGGAAA  CCTTAAAGAG GAAAACGTAA ATGGGAATGG TTCGGTGAAT GGTAATGCGA GTTCTGATAT CTTTGAGAGC CAAAACATTG TGAACTTGAG CCGGCCTGGT ATTGAGAATC TTCTGAAGAT  GGAAGACCGA AAAGACGGTT GGATGGTTGT TCTTTATGCA CCCTGGTGCC CCTTCTGTCA GGCAATGGAA GCATCGTATG AGGAACTGGC TGATAAGTTA GCTGGAAGTG GTGTAAAGGT  TGGGAAATTT AGAGCCGACG GTGAGCAGAA GACGTTCGCG AAACAAGAAT TGCAGCTTGG GAGCTTCCCG ACGATCCTTT TCTTCCCGAA GCACTCGTCA AGGCCTATTA AGTATGCGTC  CGAGAAGAGA GATGTTGACT CTTTGATGGC TTTCATTAAC GCCCTTAGAT GATGAAGAAA ACTAGAAAAG TGTGTTGTTT ATGCGCATGT ACAACTTGAT GCACGGTTTT GGTTTTGGTC  TTGGTCATTG TATAATATCC GGTATAGAAT GTAGTCCCAG TTTTGGTCTT GTGTTTGATG CAAGTTTGTT TTGTTGAGTA TTATAAGAAA CAAACATTTT TTTCTCTTAA ACATCACCTC 
AATAGAATTT GATTCTGTTT CTCTCTCATA CGCTCCTCCT CTCCTAACAT TTTT 

Retrieve as FASTA