Entry information : HaAPR02HanXRQChr15g0470721
Entry ID 14480
Creation 2017-11-03 (Christophe Dunand)
Last sequence changes 2017-11-03 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaAPR02HanXRQChr15g0470721
Name HaAPR02HanXRQChr15g0470721
Class Thioredoxin Type APR    [Orthogroup: APR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaAPR02
start..stop
S start..stop
HaAPR01 868 0 1..461 1..463
HaAPR03 760 0 1..461 42..507
ThasAPR03 714 0 12..461 20..466
ThasAPR02 714 0 29..461 32..465
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24320970..24321036 67 N° 2 24321406..24321564 159 N° 3 24321676..24321805 130 N° 4 24322139..24323168 1030
join(24320970..24321036,24321406..24321564,24321676..24321805,24322139..24323168 )


exon

Literature and cross-references HaAPR02HanXRQChr15g0470721
DNA ref. HanXRQ genome:   HanXRQChr15 (24320970..24323168)
Protein sequence: HaAPR02HanXRQChr15g0470721
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   461
PWM (Da):   %s   50828.66  
PI (pH):   %s   5.76
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALAVTSSTSIAFSSSNSRTEQGVQFGSSNFQPSDRAFAAPAALNVSRRRSLAAVNAEPKRNDSIVPSAATVFAPDVVDKQAEVEDIEKLAVDLEKASPLEIMDKALEKYGNDIAIAFSGAEDVALIEYAHLTGRPYRVFSLDTGRLNPETYKFFDTVEKHYGIRIEYMFPDAVEVQALVRTKGLFSFYEDGHQECCRVRKVRPLRRALKGLRAWITGQRKDQSPGTRSEVPVVQVDPVFEGLDGGSGSLVKWNPVANVAGNDVWNFLRTMEVPVNSLHAQGYISIGCEPCTRSVLPGQHEREGRWWWEDAKVKECGLHKGNLKEENGNGNGSVDGSQSAVVSDIFESENIVNLSRPGIENLLKMEERKDGWMVVLYAPWCPFCQAMEASYVELADKLAGSGVKVGKFRADGDQKAFAQQELQLGSFPTILFFPKHSSRPIKYPSEKRDVDSLIAFINALR

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTTGCTGTTACTTCTTCAACTTCAATCGCTTTTTCGTCCTCGAATTCACGTACCGAACAAGGTATGTTCGTTGATTCCCCTTGTTTATGTTTTTAGTTCTAGTTTTCGGGCCCG
GGGTCTGGAAAGAGCCTCTCTATCTGTGAGGTTTGTCTGCATCCCAGTATCCCGGACTCTACCAATAGTTTTGCTGATGGTGGGATTTACTGTTATGTGTTATGGTTGTTGCCATTATTT
ATTATATTTGAGGTACATGAATTGAGGTAATATTTGCCTACATCCCGTCCCATCTAGTAACCGTATGCTTTATTGATAGCTTTGTTATTTGTGGGGTTTACAGTTTAAACTGTATAGTAC
TTTATAGTGTTACGGTTGTTGCTTTATTTTTTTTTTCAATTTTGAGTAGATTTTTGAATTTGGTTATGTATTGCAGGTGTTCAATTTGGTTCGAGTAATTTTCAACCATCCGATCGGGCT
TTTGCTGCACCGGCGGCATTGAACGTCTCCCGGAGACGATCTCTGGCGGCGGTAAATGCGGAACCTAAGAGGAATGATTCGATTGTTCCGTCTGCGGCCACTGTGTTTGCTCCTG
GTATG
TGTAATTTGTTAACAGTTAGGGTTTATTTGGGATGTATAAATTATAGAGCGTAATGTACAAGTAATTGAAGCGGTGTGAATAATTGGGGGTTTGTGGATTCTGCAGATGTAGTGGATAAA
CAAGCAGAGGTTGAGGATATTGAGAAATTGGCTGTAGATCTTGAGAAGGCTTCTCCACTTGAGATTATGGATAAGGCACTTGAAAAATATGGGAATGATATTGCCATAGCTTTCAG
GTAA
TTTAATAGTACAAGCTGTAATGCATAGTGTACAACTGTTTAATGCATGTTTGAAAAATCTTAACATCTTACAACTGTCTGAAAAGGGCTTCTAACCTAGCGGCATCAATGTGTCCATTAA
AGTTGTTCTAGATATAAACATTTTTTTCGCCGAGTACTTAACCAACACCAACCGAATAGTAGTGTCGGTACCTCGGTACCGAATAGTACTTTTAAGTACGGCACTATACAAACTGAAACT
GTATTTTATAGTACGGTAGGTTTAAAGAGTGTGTGAGTTATCTGTTGTAACGACGTTCTAAAAACTGTTTTTGATTGTTTTGATTGCAGTGGTGCAGAGGATGTTGCTTTAATCGAGTAT
GCTCACTTAACCGGACGTCCATACAGAGTGTTCAGCCTCGACACGGGGCGGTTAAACCCGGAAACATACAAGTTTTTCGATACAGTTGAGAAACACTACGGCATTCGGATCGAATACATG
TTCCCCGACGCTGTTGAAGTGCAGGCTTTGGTTAGAACGAAAGGTCTGTTTTCGTTCTATGAAGACGGTCATCAAGAATGCTGCCGTGTGAGGAAGGTGCGACCGTTGAGGCGGGCGTTG
AAGGGTTTGCGGGCTTGGATCACGGGTCAAAGAAAAGACCAGTCTCCCGGGACTAGATCTGAGGTTCCGGTTGTTCAAGTGGATCCGGTTTTTGAAGGGTTGGATGGTGGCTCGGGTAGC
TTGGTGAAGTGGAACCCTGTGGCTAATGTAGCCGGTAACGATGTGTGGAACTTCCTTCGGACCATGGAAGTGCCGGTTAACTCGTTGCACGCTCAGGGGTATATTTCGATAGGGTGTGAG
CCATGCACGAGGTCGGTGTTGCCCGGTCAGCACGAGCGGGAAGGGAGATGGTGGTGGGAGGATGCCAAAGTGAAAGAATGCGGGCTGCATAAAGGAAACTTAAAAGAGGAAAACGGTAAC
GGAAATGGTTCGGTTGATGGTAGCCAGAGCGCTGTGGTCTCGGATATCTTTGAGAGTGAAAACATCGTGAACTTGAGCCGGCCCGGTATCGAGAATCTTCTCAAAATGGAAGAGCGAAAA
GACGGGTGGATGGTTGTTCTTTACGCGCCGTGGTGTCCGTTTTGCCAAGCGATGGAAGCGTCGTATGTTGAATTGGCTGATAAGTTAGCTGGAAGTGGTGTGAAGGTTGGCAAGTTTAGA
GCCGATGGTGATCAAAAGGCATTTGCGCAGCAAGAATTGCAGCTCGGGAGCTTCCCGACGATCCTTTTCTTCCCTAAGCACTCGTCAAGGCCTATTAAGTACCCGTCTGAGAAGAGAGAC
GTCGACTCGTTGATCGCTTTCATTAACGCTCTTAGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTTGCTGTTACTTCTTCAACTTCAATCGCTTTTTCGTCCTCGAATTCACGTACCGAACAAGGTGTTCAATTTGGTTCGAGTAATTTTCAACCATCCGATCGGGCTTTTGCTGCA
CCGGCGGCATTGAACGTCTCCCGGAGACGATCTCTGGCGGCGGTAAATGCGGAACCTAAGAGGAATGATTCGATTGTTCCGTCTGCGGCCACTGTGTTTGCTCCTG
ATGTAGTGGATAAA
CAAGCAGAGGTTGAGGATATTGAGAAATTGGCTGTAGATCTTGAGAAGGCTTCTCCACTTGAGATTATGGATAAGGCACTTGAAAAATATGGGAATGATATTGCCATAGCTTTCAG
TGGT
GCAGAGGATGTTGCTTTAATCGAGTATGCTCACTTAACCGGACGTCCATACAGAGTGTTCAGCCTCGACACGGGGCGGTTAAACCCGGAAACATACAAGTTTTTCGATACAGTTGAGAAA
CACTACGGCATTCGGATCGAATACATGTTCCCCGACGCTGTTGAAGTGCAGGCTTTGGTTAGAACGAAAGGTCTGTTTTCGTTCTATGAAGACGGTCATCAAGAATGCTGCCGTGTGAGG
AAGGTGCGACCGTTGAGGCGGGCGTTGAAGGGTTTGCGGGCTTGGATCACGGGTCAAAGAAAAGACCAGTCTCCCGGGACTAGATCTGAGGTTCCGGTTGTTCAAGTGGATCCGGTTTTT
GAAGGGTTGGATGGTGGCTCGGGTAGCTTGGTGAAGTGGAACCCTGTGGCTAATGTAGCCGGTAACGATGTGTGGAACTTCCTTCGGACCATGGAAGTGCCGGTTAACTCGTTGCACGCT
CAGGGGTATATTTCGATAGGGTGTGAGCCATGCACGAGGTCGGTGTTGCCCGGTCAGCACGAGCGGGAAGGGAGATGGTGGTGGGAGGATGCCAAAGTGAAAGAATGCGGGCTGCATAAA
GGAAACTTAAAAGAGGAAAACGGTAACGGAAATGGTTCGGTTGATGGTAGCCAGAGCGCTGTGGTCTCGGATATCTTTGAGAGTGAAAACATCGTGAACTTGAGCCGGCCCGGTATCGAG
AATCTTCTCAAAATGGAAGAGCGAAAAGACGGGTGGATGGTTGTTCTTTACGCGCCGTGGTGTCCGTTTTGCCAAGCGATGGAAGCGTCGTATGTTGAATTGGCTGATAAGTTAGCTGGA
AGTGGTGTGAAGGTTGGCAAGTTTAGAGCCGATGGTGATCAAAAGGCATTTGCGCAGCAAGAATTGCAGCTCGGGAGCTTCCCGACGATCCTTTTCTTCCCTAAGCACTCGTCAAGGCCT
ATTAAGTACCCGTCTGAGAAGAGAGACGTCGACTCGTTGATCGCTTTCATTAACGCTCTTAGATGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTCACCTTTC ATAATCCGTT TTCTCCTCCG TTTGTATATA TAAGTTTCCG CCCTCTTCAC AACTTCCATC TCATCATCAA CAACAAGTTA AATAGATTCA ATCAGTTTTT ATTCGTGTTT  CAATTTCAAT CCTTTAATTA CAATGGCTCT TGCTGTTACT TCTTCAACTT CAATCGCTTT TTCGTCCTCG AATTCACGTA CCGAACAAGG TGTTCAATTT GGTTCGAGTA ATTTTCAACC  ATCCGATCGG GCTTTTGCTG CACCGGCGGC ATTGAACGTC TCCCGGAGAC GATCTCTGGC GGCGGTAAAT GCGGAACCTA AGAGGAATGA TTCGATTGTT CCGTCTGCGG CCACTGTGTT  TGCTCCTGAT GTAGTGGATA AACAAGCAGA GGTTGAGGAT ATTGAGAAAT TGGCTGTAGA TCTTGAGAAG GCTTCTCCAC TTGAGATTAT GGATAAGGCA CTTGAAAAAT ATGGGAATGA  TATTGCCATA GCTTTCAGTG GTGCAGAGGA TGTTGCTTTA ATCGAGTATG CTCACTTAAC CGGACGTCCA TACAGAGTGT TCAGCCTCGA CACGGGGCGG TTAAACCCGG AAACATACAA  GTTTTTCGAT ACAGTTGAGA AACACTACGG CATTCGGATC GAATACATGT TCCCCGACGC TGTTGAAGTG CAGGCTTTGG TTAGAACGAA AGGTCTGTTT TCGTTCTATG AAGACGGTCA  TCAAGAATGC TGCCGTGTGA GGAAGGTGCG ACCGTTGAGG CGGGCGTTGA AGGGTTTGCG GGCTTGGATC ACGGGTCAAA GAAAAGACCA GTCTCCCGGG ACTAGATCTG AGGTTCCGGT  TGTTCAAGTG GATCCGGTTT TTGAAGGGTT GGATGGTGGC TCGGGTAGCT TGGTGAAGTG GAACCCTGTG GCTAATGTAG CCGGTAACGA TGTGTGGAAC TTCCTTCGGA CCATGGAAGT  GCCGGTTAAC TCGTTGCACG CTCAGGGGTA TATTTCGATA GGGTGTGAGC CATGCACGAG GTCGGTGTTG CCCGGTCAGC ACGAGCGGGA AGGGAGATGG TGGTGGGAGG ATGCCAAAGT  GAAAGAATGC GGGCTGCATA AAGGAAACTT AAAAGAGGAA AACGGTAACG GAAATGGTTC GGTTGATGGT AGCCAGAGCG CTGTGGTCTC GGATATCTTT GAGAGTGAAA ACATCGTGAA  CTTGAGCCGG CCCGGTATCG AGAATCTTCT CAAAATGGAA GAGCGAAAAG ACGGGTGGAT GGTTGTTCTT TACGCGCCGT GGTGTCCGTT TTGCCAAGCG ATGGAAGCGT CGTATGTTGA  ATTGGCTGAT AAGTTAGCTG GAAGTGGTGT GAAGGTTGGC AAGTTTAGAG CCGATGGTGA TCAAAAGGCA TTTGCGCAGC AAGAATTGCA GCTCGGGAGC TTCCCGACGA TCCTTTTCTT  CCCTAAGCAC TCGTCAAGGC CTATTAAGTA CCCGTCTGAG AAGAGAGACG TCGACTCGTT GATCGCTTTC ATTAACGCTC TTAGATGATG ATGACGAGGA AGAAGATGGT GTCGTGTTTG  TGCATTGATA ACTTGTACGC GAATGTACAA TCGAGTGATG ATTTTGGTTT TGGTCATTGT ATAATATTCG TATAGTCAGT CACCTCCTGG GGAATGATCG TTTCCAGATA TTAATTAAGT  GGTTATTCCG AAAATGATAA AAAACTTTTG GGCCCCGTGC GAGACAAAAA CTTTGGGCCC TCTTGCTATA ATATAAACTC ATTAATCGTA TATAAAAAAA ACCACAATAC TTAAGCGAAT  CGTGAGGTTT TTTAGCAATT TTGAAAGTAA AGTTCTAGAT CAAGTATTTA TAATCCATGC CGATTCTTCT CTATATTTCA ATGTATCATA ATTATCCATG TTCATAGAGT GAATGCTAGC 
ATTGATTAAA AACAATAAAT CCTAG 

Retrieve as FASTA