Entry information : HaAPR03HanXRQChr16g0515511
Entry ID 14481
Creation 2017-11-03 (Christophe Dunand)
Last sequence changes 2017-11-03 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaAPR03HanXRQChr16g0515511
Name HaAPR03HanXRQChr16g0515511
Class Thioredoxin Type APR    [Orthogroup: APR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaAPR03
start..stop
S start..stop
HaAPR01 792 0 42..507 1..463
HaAPR02 786 0 42..507 1..461
ThasAPR01 714 0 42..507 1..458
AtAPR03 707 0 83..507 41..458
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 104544728..104544923 196 N° 2 104544473..104544640 168 N° 3 104543731..104543860 130 N° 4 104542844..104543642 799
N° 5 104542525..104542755 231  
complement(join(104542525..104542755,104542844..104543642,104543731..104543860,1 04544473..104544640,104544728..104544923))


exon

Literature and cross-references HaAPR03HanXRQChr16g0515511
DNA ref. HanXRQ genome:   HanXRQChr16 (104544923..104542525)
Protein sequence: HaAPR03HanXRQChr16g0515511
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   507
PWM (Da):   %s   56109.4  
PI (pH):   %s   6.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNLKGRPSPSITPFLLSSFYKSLSPIHPQIIHSKTDFESSAMALAVTSSSIAISSSSSSSLRAEQVVQLNTTTFQPSDRAHLVSPTILSLSVKRSVVVKALNPESRRNDAIVTSAATTFAPDVMEKSVEVEDFEKLAKDLENSSPLEIMDKALEKYGNDIAIAFSGAEDVALIEYAHLTGRPYRVFSLDTGRLNPETYKFFDAVEKHYNIRIEYMFPDSVEVQALVRTKGLFSFYEDGHQECCRVRKVRPLRRALKGLRAWITGQRKDQSPGTRSQVPVVQVDPVFEGLDGGSGSLVKWNPVANVAGNDIWNFLRTMDVPVNSLHAQGYVSIGCEPCTRAVLPGQHEREGRWWWEDAKAKECGLHKGNIKEESVNANGNDTLHANASVSDIFNSNDILTLTRPGMENLLKMEGRKDPWIVVLYAPWCQFCAMEASCVELAEKLGGSGMKVGKFRADGDEKAFAQQELQLGSFPTILFFPKHSSRPIKYSSEKRDVDSLMAFVNALR*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACCTAAAGGGCCGCCCCTCACCATCTATCACCCCCTTTCTTCTCTCTTCATTTTATAAATCTCTCTCTCCCATTCATCCTCAAATCATTCATTCTAAAACAGATTTTGAATCTTCA
GCAATGGCGTTAGCTGTTACCTCTAGCTCCATTGCAATTTCATCGTCTTCTTCTTCCTCGTTGCGTGCAGAACAAG
GTAATATAATCTTTAATTTTTAACGTATCATATTTGAATTGGGA
TTTTTTTTTTGTTTACATATTTATTTATTAATTTGTTTTGCAGTGGTTCAGTTGAATACGACGACGTTTCAGCCGTCTGATCGGGCTCATCTGGTATCACCGACGATTTTGAGTTTATCT
GTGAAACGATCTGTTGTTGTGAAGGCGTTGAATCCTGAATCTAGGAGGAATGACGCGATTGTTACGTCAGCTGCCACCACTTTTGCTCCAG
GTAATTTTATAAAATTGTTGAAGGAGAAT
TATTACTGTTATAAAGGATTTCCCTTATTTTAGTTTTGACTTTTAAGGTCAAAGTCTTGTGGATTTTACAATCGGTTATAGTTTAGTTAAGTGAGACTTTACAATCGGTTATAGTTTAGT
TGAGCAAACTGCCATTTTGGGTTTTGGTTATTTTTGCTACTTTAGTTCAAAACTTAAATCTTTTGAATCTGGTCTCTATGTTTCAGTTTTATTATCATTTTCATTCAAAAGTAATTAGCT
GAGATTTGTCAAATAAAATTGTGGTTTTTTTGTCCTTTTCTTCAGTCGCAAAATGATCATTATAAGTTTTATTATAAGGGATTTAATTAATAATTTGTTATAGTAAAATTTATAATGACT
ATTTTGTCCCTTGAAAAGGACAAAACAAGGATTATATTTGACAAATTTGAGCTGATTTAATTTTTGATGAAAATGACAATAAAACTCAAAACCAAATGTTTGAGTTTTGGACTAAAGTTG
TTATAAAATCTGATATATTCATGCGTTATTAACTGAAGTGATTAAATTCATGAGTGAGTGAGGTTGTGAAATGACAATAACACCCTTTGCATTGGATTTACAGATGTGATGGAGAAATCA
GTAGAAGTTGAGGACTTTGAAAAATTAGCTAAAGACCTTGAGAATTCTTCCCCACTTGAAATCATGGATAAAGCCCTTGAGAAATATGGCAATGATATTGCCATTGCCTTCAG
GTAAATC
ATACAACCATCATTTGTACACCTATTTATGCACCATGTACAAACTTCTAATGCATATAAATACTTGTTAATAATTCTACAGTGGTGCTGAAGATGTTGCTTTGATTGAGTATGCACACCT
CACAGGCCGACCGTATCGCGTATTTAGTCTCGATACCGGGAGATTAAACCCGGAAACATACAAGTTCTTTGACGCGGTCGAAAAACATTACAACATCCGGATCGAATACATGTTCCCAGA
TTCCGTAGAAGTTCAAGCCTTGGTTAGAACCAAGGGTCTGTTCTCATTTTACGAAGACGGGCATCAAGAATGCTGTCGAGTGAGAAAGGTTAGACCGTTGCGACGCGCTTTGAAGGGGTT
ACGAGCATGGATCACCGGTCAACGAAAAGACCAGTCACCCGGGACGCGCTCACAAGTCCCCGTGGTTCAAGTAGACCCGGTTTTTGAAGGGTTAGATGGTGGGTCAGGGAGCTTGGTGAA
ATGGAACCCTGTGGCTAATGTTGCTGGTAATGATATTTGGAACTTCTTACGAACCATGGATGTCCCGGTTAACTCGTTGCATGCTCAAGGGTATGTTTCCATCGGGTGCGAGCCGTGCAC
CAGGGCCGTGTTGCCCGGTCAACACGAGCGGGAAGGAAGGTGGTGGTGGGAGGATGCGAAGGCGAAGGAATGCGGGTTACATAAAGGAAACATCAAAGAGGAATCGGTTAATGCGAATGG
GAATGATACCCTTCATGCTAACGCAAGTGTTTCGGATATCTTTAATAGCAATGACATCTTGACTTTGACCCGACCCGGAATGGAAAACTTGCTCAAAATGGAAGGCCGAAAAGATCCATG
GATAGTTGTTCTTTATGCACCTTGGTGCCAATTCTGTCAG
GTACTAAACCTTAAAATTGTATAATTTTATTAATATTTTAGCCCGTTACCCAACCAGTATATTTATGTTGTTTTTTACGC
GATCACAGGCCATGGAAGCCTCTTGTGTTGAATTGGCGGAAAAGTTGGGTGGGAGTGGCATGAAGGTCGGGAAATTTAGGGCGGACGGTGATGAAAAGGCGTTTGCGCAGCAAGAATTGC
AGTTAGGGAGTTTTCCGACCATTCTTTTCTTTCCAAAACACTCGTCTAGACCGATCAAGTATTCTTCCGAGAAGAGGGATGTCGATTCGTTGATGGCTTTCGTGAATGCGCTCCGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACCTAAAGGGCCGCCCCTCACCATCTATCACCCCCTTTCTTCTCTCTTCATTTTATAAATCTCTCTCTCCCATTCATCCTCAAATCATTCATTCTAAAACAGATTTTGAATCTTCA
GCAATGGCGTTAGCTGTTACCTCTAGCTCCATTGCAATTTCATCGTCTTCTTCTTCCTCGTTGCGTGCAGAACAAG
TGGTTCAGTTGAATACGACGACGTTTCAGCCGTCTGATCGGGCT
CATCTGGTATCACCGACGATTTTGAGTTTATCTGTGAAACGATCTGTTGTTGTGAAGGCGTTGAATCCTGAATCTAGGAGGAATGACGCGATTGTTACGTCAGCTGCCACCACTTTTGCT
CCAG
ATGTGATGGAGAAATCAGTAGAAGTTGAGGACTTTGAAAAATTAGCTAAAGACCTTGAGAATTCTTCCCCACTTGAAATCATGGATAAAGCCCTTGAGAAATATGGCAATGATATT
GCCATTGCCTTCAG
TGGTGCTGAAGATGTTGCTTTGATTGAGTATGCACACCTCACAGGCCGACCGTATCGCGTATTTAGTCTCGATACCGGGAGATTAAACCCGGAAACATACAAGTTC
TTTGACGCGGTCGAAAAACATTACAACATCCGGATCGAATACATGTTCCCAGATTCCGTAGAAGTTCAAGCCTTGGTTAGAACCAAGGGTCTGTTCTCATTTTACGAAGACGGGCATCAA
GAATGCTGTCGAGTGAGAAAGGTTAGACCGTTGCGACGCGCTTTGAAGGGGTTACGAGCATGGATCACCGGTCAACGAAAAGACCAGTCACCCGGGACGCGCTCACAAGTCCCCGTGGTT
CAAGTAGACCCGGTTTTTGAAGGGTTAGATGGTGGGTCAGGGAGCTTGGTGAAATGGAACCCTGTGGCTAATGTTGCTGGTAATGATATTTGGAACTTCTTACGAACCATGGATGTCCCG
GTTAACTCGTTGCATGCTCAAGGGTATGTTTCCATCGGGTGCGAGCCGTGCACCAGGGCCGTGTTGCCCGGTCAACACGAGCGGGAAGGAAGGTGGTGGTGGGAGGATGCGAAGGCGAAG
GAATGCGGGTTACATAAAGGAAACATCAAAGAGGAATCGGTTAATGCGAATGGGAATGATACCCTTCATGCTAACGCAAGTGTTTCGGATATCTTTAATAGCAATGACATCTTGACTTTG
ACCCGACCCGGAATGGAAAACTTGCTCAAAATGGAAGGCCGAAAAGATCCATGGATAGTTGTTCTTTATGCACCTTGGTGCCAATTCTGTCAG
GCCATGGAAGCCTCTTGTGTTGAATTG
GCGGAAAAGTTGGGTGGGAGTGGCATGAAGGTCGGGAAATTTAGGGCGGACGGTGATGAAAAGGCGTTTGCGCAGCAAGAATTGCAGTTAGGGAGTTTTCCGACCATTCTTTTCTTTCCA
AAACACTCGTCTAGACCGATCAAGTATTCTTCCGAGAAGAGGGATGTCGATTCGTTGATGGCTTTCGTGAATGCGCTCCGATGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACCTAA AGGGCCGCCC CTCACCATCT ATCACCCCCT TTCTTCTCTC TTCATTTTAT AAATCTCTCT CTCCCATTCA TCCTCAAATC ATTCATTCTA AAACAGATTT TGAATCTTCA  GCAATGGCGT TAGCTGTTAC CTCTAGCTCC ATTGCAATTT CATCGTCTTC TTCTTCCTCG TTGCGTGCAG AACAAGTGGT TCAGTTGAAT ACGACGACGT TTCAGCCGTC TGATCGGGCT  CATCTGGTAT CACCGACGAT TTTGAGTTTA TCTGTGAAAC GATCTGTTGT TGTGAAGGCG TTGAATCCTG AATCTAGGAG GAATGACGCG ATTGTTACGT CAGCTGCCAC CACTTTTGCT  CCAGATGTGA TGGAGAAATC AGTAGAAGTT GAGGACTTTG AAAAATTAGC TAAAGACCTT GAGAATTCTT CCCCACTTGA AATCATGGAT AAAGCCCTTG AGAAATATGG CAATGATATT  GCCATTGCCT TCAGTGGTGC TGAAGATGTT GCTTTGATTG AGTATGCACA CCTCACAGGC CGACCGTATC GCGTATTTAG TCTCGATACC GGGAGATTAA ACCCGGAAAC ATACAAGTTC  TTTGACGCGG TCGAAAAACA TTACAACATC CGGATCGAAT ACATGTTCCC AGATTCCGTA GAAGTTCAAG CCTTGGTTAG AACCAAGGGT CTGTTCTCAT TTTACGAAGA CGGGCATCAA  GAATGCTGTC GAGTGAGAAA GGTTAGACCG TTGCGACGCG CTTTGAAGGG GTTACGAGCA TGGATCACCG GTCAACGAAA AGACCAGTCA CCCGGGACGC GCTCACAAGT CCCCGTGGTT  CAAGTAGACC CGGTTTTTGA AGGGTTAGAT GGTGGGTCAG GGAGCTTGGT GAAATGGAAC CCTGTGGCTA ATGTTGCTGG TAATGATATT TGGAACTTCT TACGAACCAT GGATGTCCCG  GTTAACTCGT TGCATGCTCA AGGGTATGTT TCCATCGGGT GCGAGCCGTG CACCAGGGCC GTGTTGCCCG GTCAACACGA GCGGGAAGGA AGGTGGTGGT GGGAGGATGC GAAGGCGAAG  GAATGCGGGT TACATAAAGG AAACATCAAA GAGGAATCGG TTAATGCGAA TGGGAATGAT ACCCTTCATG CTAACGCAAG TGTTTCGGAT ATCTTTAATA GCAATGACAT CTTGACTTTG  ACCCGACCCG GAATGGAAAA CTTGCTCAAA ATGGAAGGCC GAAAAGATCC ATGGATAGTT GTTCTTTATG CACCTTGGTG CCAATTCTGT CAGGCCATGG AAGCCTCTTG TGTTGAATTG  GCGGAAAAGT TGGGTGGGAG TGGCATGAAG GTCGGGAAAT TTAGGGCGGA CGGTGATGAA AAGGCGTTTG CGCAGCAAGA ATTGCAGTTA GGGAGTTTTC CGACCATTCT TTTCTTTCCA  AAACACTCGT CTAGACCGAT CAAGTATTCT TCCGAGAAGA GGGATGTCGA TTCGTTGATG GCTTTCGTGA ATGCGCTCCG ATGATAAATA GTTCGAGTTT GATGGGTGTA GGTTGTGTAT  TTATGTAGAC AATGGTCTGT TTTAGTGAGT GTGGGCTAAG TCCCGCTATT TGGGTTGTTG GAAGTTTTGA GCATCACGGA ATTAAGTGGA GGAATAAAAT TGCAATTTTT ATATGACCAC  ATTTCAAATC GTGTTTAGTA TTTGATTTTC AAGGAAAAAG TTATGGTTTG GGGGTTCGCT TTTAGTTTTT TGTTTCTTTG TGTTTTGATG AGCCTGAAGA GGCACCCAAT AATTCGGGGT 
TTTGGTGGGT TGACCG 

Retrieve as FASTA