Entry information : HaTrx08 (HanXRQChr13g0396471)
Entry ID 14496
Creation 2017-11-03 (Christophe Dunand)
Last sequence changes 2017-11-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-03-08 (Christophe Dunand)
Peroxidase information: HaTrx08 (HanXRQChr13g0396471)
Name (synonym) HaTrx08 (HanXRQChr13g0396471)
Class Other Thioredoxin    [Orthogroup: Trx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaTrx08
start..stop
S start..stop
ThasTrx03-1 837 0 70..543 43..508
AtTrx03 817 0 64..543 57..529
ThasTrx03-2 787 0 12..543 7..521
HaTrx09 312 1e-102 91..405 59..370
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 69478682..69478934 253 N° 2 69476941..69477148 208 N° 3 69474995..69475100 106 N° 4 69473585..69473854 270
N° 5 69471799..69472101 303 N° 6 69470968..69471075 108 N° 7 69470783..69470869 87 N° 8 69469765..69469869 105
N° 9 69469541..69469671 131 N° 10 69469315..69469375 61  
complement(join(69469315..69469375,69469541..69469671,69469765..69469869,6947078 3..69470869,69470968..69471075,69471799..69472101,69473585..69473854,69474995..6 9475100,69476941..69477148,69478682..69478934))


exon

Literature and cross-references HaTrx08 (HanXRQChr13g0396471)
DNA ref. HanXRQ genome:   HanXRQChr13 (69478934..69469315)
Protein sequence: HaTrx08 (HanXRQChr13g0396471)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   543
PWM (Da):   %s   59175.89  
PI (pH):   %s   6.45
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATTTAQIANGVGIRNSGRPTSAAPSTPALTSNSILLSFTRPRASTLRFHSVVNFAGRFSAFRRSPPPCSLRASASSAEQPTSSGQDVENLVIIGSGPAGYTAAIYAARANLKPVVFEGYQVGGVPGGQLMTTTEVENFPGFPEGITGPDLMDRMRRQAERWGAELHQEDVEFIDANNRPFTVQSTDRVKCHSIIVATGATAKRLNLPREDEFWSRGISACAICDGASPLFKGQVLAVVGGGDTATEEAIYLTKYARHVHLLVRRDQMRASKAMQDRLVDSGECFRVLDNPNITVHYNTETVDVVSNTKGQMSGIKLKKLDTGEESVLEAKGLFYGIGHTPNSQLLQGQIDLDSAGYILVKDGSAETSLEGVFAAGDVQDHEWRQAITAAGSGCVAALSVERYLVGNNLLIEFHQPHTEEVKKELTPRDVQEGFDISLTKHRGQYALRKLYHESPRLICVLYTSPTCGPCRTLKPILGKVIDEFDQNVHFVEIDIEEDPEVAEAANVMGTPCVQFFKNKEMIRTVSGVKMKKEYREFIEANK

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACAACTACTGCTCAGATTGCCAATGGCGTCGGCATCCGTAACTCCGGCCGCCCTACCTCCGCCGCTCCCTCCACTCCTGCTCTCACTTCAAACAGCATCTTACTCAGTTTCACT
CGTCCACGCGCCTCCACGCTTCGTTTTCACTCCGTAGTTAACTTCGCCGGTCGCTTCTCTGCCTTCCGTCGTTCTCCGCCGCCGTGTTCCTTACGCGCCTCCGCTTCATCCGCCGAACAG
CCTACATCTTCAG
GTTTTTGTTTTAACTGCTTGTTTGTAGCTGCATCTGTGTTTTTGTATCGTTTTACATGTGCATTTTCAGATTATAATTTCAGTTTAGCAGCTCTATTTGTAGAATTA
TGTAGATTTTGGTGTCAGTAGTACTAATATGGAGATAGAGCACCTGGAATTAGGTTATGGATATATATAATTTTACGCCTATAGGCTGTATTCTGAAATTATAATTTCAAATTAGTGCAT
GTGTTTGTATAATTATGTGGTTTTTGATGTGAACATCGGTATGAGCCTTATGGATATGGAAAATTCAAAATTAAATTAGAGCATTATGAATTAGGTTATAGATAGAATTCAACGCCAGTT
AATGTTGTATTTGATGCGAACATTGTGTGAGCCGTATGGCTATCCAAAATTGAAATATAGCACCATGAATTAGGTTATGGATAGAATATAAACCAATTAATGCTGTATTTGTAGTTTATC
TATAGATCTGCATTCTGAAATTGGATTATCAATTTAGTGCTTGTATTTGTAGAATTGTGTTGTGAACGTTGGTATGAGCCGTATGGATTTCAAAATAGAGCAGCGCCAGGAATTAGGTTA
TAGATAGAATTTAACACCAACTGATGTATTTGTAGTTCATCAATAGAACTGCATTCTGAAATTAGAGTTTTTCAATATAGTACTTGTATTTGTAGAAATATGTGAATTTGTTGCAAACAT
TGTGTGAGCCGCATGACTATTGAAAATTGAAATAGAGCATTATAAATTAGGCTATAGATAGAATATGTTTTATCAGTTGTAATGTTCATAATAGTTTGCATATGTTTCTAGAGAAGGTTG
GAATTCGTAGTGATTATTTTATTGAGGTGTACGCTCTCATCCATTGGAAACTGCAACTTACCTTTTTTTTATGTTCATGAAAATTAAATCATTCATATATATTTTTTTTTTAAAATAAAA
TGTTAAAATGAGAAATTGTTGCTATTGATATGGGCCTGCATGGCACGTGTACGTAAATTGTTGCCATTTTTATGGAATGAATGAAAGACCAGTGCAATACAAATTAATCGAAAATGTATC
TGTTTTGCTTTTGGGTAATAGAGCGAGTAAAAATGACATCAGTGAGTGACATTTAGCAAAAGGTTAAATATTTCGACAACTACAATAGTTAATCTTCCTACATTCTAGCTAACTTCAATA
TTGTTATTGCATTTTTTAACATATAATAACTGCTCAACACTAGTCTAAGTGTAATGGTTGGAAGTATCATTTCCTCATAAGATATTACTTCCTTAAATTCGCCTATATGTACAGGACTCT
TATTATAGGACCTTTTGCATATTACCTTACGAATAGAATCATAGATTGAGAGACTCAAATAGTTATTTGTGAACTTATAGAACACTGACATATAGATTAACTCATATTATATAGGGGAAC
AGCAGCACTAATGCGTGTCACGTTTATAATCTTGAATTTTAGTTTTTTTAAGTTTAAAGAGATCTATTGATGATGTACTATCTGACTTAATCTTTTGTTTTAGCAGGGCAAGATGTTGAA
AATTTGGTAATCATAGGATCGGGTCCCGCGGGATACACAGCAGCCATTTATGCAGCGCGTGCGAATTTGAAGCCTGTAGTGTTTGAGGGGTATCAAGTTGGCGGTGTTCCTGGTGGACAA
TTGATGACCACCACTGAAGTGGAGAACTTTCCAGGTTTCCCGGAGGGAATTACTGGTCCAGACTTGATGGATAG
GTAAGTTGCTTTTTTTAATACTTAAGTGGTGGGAATTTCCGACTTG
TTTCTCATGAATGGGTAGGGTCTGTAAACGAACCGAATGTTCATGAACTTGTTCGGTGGGAAGTTCGTTTATTTAATAAACGAACGGACATGAACACAATTTTCTGCTCATTTAATTAAA
CGAACGAGCATGAACACACGTTTTGTTCGTTCATTTATGTTCTTTCATTTACATTTGTTTATGTTCGTTTCATTTTAAATACACAAGTAGTTATATTTATATAAATATTAAACATAAAAG
GAGCTTTCTAACTACATAAATTATATATATCTTAAAAACCATGGTCGGTGGACCATGGTTTGAAATTGTCTTTTTTTGACCCTCAAATTTACACACTTTACACATCCAACCCCAATCTTT
TGGTAAGTAACACATTGATCCTTAACTTTTGTTATTTAACAACTTTGACCCCTTATATATATATCTTAAAAACCATGGTCGGTGGACCATGGTTTGAAATTGTCTTTTTTGACCCTCAAA
TTTACACACTTTACACATCCAACCCCAATTTTTTGGTAAGTAACACATTGATCCTTAACTTTTGTTATTTAACAACTTTGACCCCTGATTTATTTCTACTTAATAATTTCACACCTCATC
TTCCCCGACACTTCAATTCTTTTGTTTAAATTACTTAACTTTACACTACAACGTGCGAGACGTTTTACTTTTTTTAATCTATGCCTAACCACATTAATGTCACTATTGTAATGTTTGTAA
CAAAGTAAAATACCTGTCACGTCACGCGTGGGCACCACACGTTAATGTCATCATCGTATCGCATGTAACGAAGTCACAACCGTGACGTTGCCGCCGCAACGCGCGGCATGGGTAAAAATC
TAGTAATAAATATAACTAATTGGTAATTGGGCTTTCTAGTAATAAAAATGGGGTTTCCAATGGAATTTATCGTAATTAATCACTAATTTATATAAAAAATTACTTTATGTTTGGTCAATT
ATGTTCATTTGTGTTTGTTCAATTATGTTCATTTGTGTTGTTTATTGTTAAATTATGTTCGTTTAAGTTTGTTTGTTTACGTTCGTGAACTTTTCGTTTAAATTTTAAATGAACGAACAT
AAACGAACACTAACATGCCCATTTTCTTAATAAACGAACATGAACAAAAAAATGTACTCGATTATATGTACATGTTCGTTCGATTCATTTATAGGCCTATGAATGGGTCAATATGAGTTG
TCGGTTGTGTTTACCTTTAACTAGACAAACAGGTAAAATCAAGAAAGTTAGGGTAAATGGGAACAAGTTGAACGGTTGAAAGTCATCCAAAGTATGTCTTTTGGAAGCATAAAACTTCTT
AAATTGTTTTTATCCAGTGAATATAGATGTTCTGTGCATATAATACCAACATACCTTATCATTTGTTCCGTTTTAGTGATTGTACTCTTGTTTGTATATTCAAGTCGTCAAAAGATGATT
TTACGTCCTGTTTGGGTCTTTCTGTATGCAAAAAATGGTTGTAAAAAATGATTATGTTTATATAAAGATGTTTATGTTTAGATAGATTTATGTATAGTGTTAACTTTATATAATGATATA
TTATTTAACGCAGCACACAACATTTTAAAGTGACTCATGATTCAAATGTACAAAAAAGTGCAATGACTAAATTGGGACAAATGTAAAGGTCCGTTGATATGTTGTGCAAAAACCCTACTG
ATATAATTTTTGTAATCATATGGTTGGCACTTTAATTATTTATATAAAAATGTTTGTTTTTTTGACAAAACAATAGGGGTTATCGAGCTTAATTTTTGATGTTTGTATTTATAGGATGCG
CCGTCAAGCTGAGCGTTGGGGAGCAGAACTTCATCAGGAGGATGTAGAATTTATTGATGCGAATAACCGTCCTTTTACTGTGCAAAGCACTGACCGCAAG
GTGATGCTTAATCTTATTAG
CATGTGAATCTTCCAATTTATTAGCTAGTGTAATGTAATAAATAGAAATGAACAAAAAAAATGGGATAATATATACATAGGCCACCTAAGTATTTAAACAACTTAAGAGGCCACTCAAAT
ATCAATGGGTTTTGTTTATTTTACCAGTTTCGACAAAAAATATGCAGACAATTTGGAAAAATGACAAATGCTTCTAAGTTAGAAGTTTTTGTCACATCTAGCGTTGTAAGAATGACAAAT
GCCCCTAAATCTACTATAAACATATAATGGGTAGGTCCATGCCATTTTACAACTCTAGATGTAACAAAAAACTTTAAATGTAGGGGCAATTTTGTCACTTCACAACTATGCAGTTAATGC
GGTAAAATATAGGATATCGGTCAAGGACCGATATTTGAGATATAGGATATCACGGTGGGATATTGGTAATTTTAATATCATGCAAAATTTATATATATAGCAATTTAACATGAACAATTC
AGTATACTCTCCTACCATTAACAATTAACCTTTTGCAACTTGCAAAACACCAACAATTGTAGCAAGTAGGTACTGATTAAGACTTAAAACACTAACACTAATAATTAACAATCAAGACTT
AAAACACTAATAGCAGCAATAAGAAGAAAGACGAATGGTAGAACTAAGAAGAAGGTACTGATATTGGGAAAATTGGTGATATGACCGATATTCCGATCGATATTTGACACCGATATTGTA
CATGGGGACCGATAACCGATATCACCGATATTACCGATATTTTACATTGGGATCAATACTTTCTACCAGTATTTTACCAGTTTTTACCTTCAGATACCAACCGTACCGAGCATTTTCGCT
ACCGGTACCCAATTTTGGCGATTTTCGGGATTGGTACTTTTGGTACTGGTATGGTTCGGAACCGGTACGGTACTGAGCTCATCATATTCACATTTGTAAAGATTTAATATCTTCATTTCT
TTGATCCAAGGGCCCTGATGAGTGCTTTCATTTTCAACTTTTTTTGTGGTTCTCAAATGAACTTTCATCTATCTGATGAAACATCATATATAGTCCTAATGAAGAACTTCAAAATTTTTA
TTTTCTTAATTGTTTTTATTTATTTTCTATACATTTTCAGGTGAAATGCCATAGTATTATAGTAGCTACAGGAGCAACTGCCAAAAGATTGAATTTACCTCGCGAAGATGAGTTTTGGAG
TAGGGGAATCAGTGCATGCGCAATTTGTGATGGAGCTTCACCGCTTTTCAAGGGTCAAGTTCTTGCAGTTGTTGGTGGAGGTGATACAGCTACTGAGGAAGCAATATATTTGACTAAATA
CGCTCGACATGTTCATTTACTTGTACGCAGGGACCAAATGAGGGCATCGAAAGCTATGCAAGATAGGTTA
GTTATAATGCCGTTTCATCTACATTTAATTATATTATTATAATATTTGAA
TTTGTTTGGTTCGTAGGTGTTGTGTAGAGATGTGCAGTTTGAATGGCAATTGCTTAGTATGGGTTGAAAAAGGGCGGGGTCACCTTTTTGTCCATTGTTGAAAAGAATTTGTTACGAAGT
AATTAACTACGTAAAAAGTATAATTACAGTAATGATCTAAATCTTTAAATTAAGTGTTTTTCTAACTCTAGCCGTTAGGATGGTTAAGAGCCTAATTTCCCATAACCACCAATAGGATGT
GTAGGTAATGCGTTAAAAATCGGATATCGGTCAAGGACCTATATTTGAGATTTAGGTTATCGCGGTGGGATATCGGTAATTTTATTATCATGCATAGCAATTTAACACTAACAACTCAGT
ATACTCTCAGTTTCTCCTACCCACTAACAATTGTAGCAAGTAGGAACTCATTAAGTCTTAAAACACTAACAATTAAGACTTAAAACACTAGTAGCAGCAATAAGAAAGATGAATGGTAGA
ACTAAGAAGAAAGGTACCAATATCGGGAAAATCGGTGATATCTCGGTCAATATTGCCGATAATATTGGTACCCCTGACCGATATTTGACACCGATATTTTACATGGGGACTGATCACCGA
TATATCACCGATGTTAACTGCATAGCCACTGGGTAATTGGAATCTAACTTTTATTGATGATCCTTTCCGAATCATCTGGTAGTTAAAAAACCAACTAGTGGTTGTTATCACTATGTTTTA
TTTTCTAAAACGGGTGGAAGTTAGACTTTTAACCTTAGCCCTAAACCCTTGACTAGAATGATCTAGGTAGTTGTGAAGAAGCCCCTATTAGCTTAATTGTTTGCTTTGACTTATTGGACT
TGTTTTTAAGATGTAACACAACCCAAATTAACCCGTTTATAACTAAATGGGTCGAAAGAGTGACTCAAGTGTTATATGCTTAATTCTTCTTACTATTTGCATTGTTTTTAACTTTTATTA
ATATGCATTTATATTACAGTAGAATGATTCGTATAAGTTTGTCCATAAATAGGATGCTTGTTAACCAGAATAGAAAGCAGAGACTAACTTTGGTCACCTTTTGATGAAATTACCCCTACT
GAAAAGGCCTAACATTGCTTGTTAATATTTTCAAATAGTTGTTTTTATCAGTTAACAACCGTAGTCCACTTTTTCCTTTCAGTAAATGAAAAACTTTGAGGTTTAACAAGCAAGTCTAAG
ATTCGTAGGTTTTAGGGTTTATTTCTTAGGTTTTAGGGATTAAGGTTTAGAGTTTAGGGTTTAATTTTTTTGGGGTTTAGGGTTTAGTAATGATTAGATAGAGTTTTATGGAGTTTTCTC
ACAAAAAGGAGTTTTCTCATGATCCGTCCCCTATTACAATTTAGGTCAACCAAAATTTAGAGAATTTAATTAATGCATTTTAGTTTTGAACTCCCTGAATGTTTGTTTAACAGGTTGATT
CTGGCGAATGTTTCAGAGTTCTTGACAATCCAAATATCACAGTGCACTACAACACAGAGACGGTGGATGTTGTCAGCAACACAAAAGGACAAATGTCTGGCATAAAACTCAAGAAACTTG
ATACCGGTGAGGAATCAGTGCTGGAAGCTAAGGGCTTGTTCTATGGAATCGGTCATACCCCAAACAGCCAGTTGTTACAAGGTCAAATTGACCTTGATAGCGCCGGTTATATATTGGTCA
AAGATGGAAGTGCAGAGACTTCCTTAGAAGGTGTGTTTGCTGCTGGAGATGTTCAG
GTAATATTATATACCAAAATTCTTATTATTCTGTTTACGTTTGATACCTTGTTTTTGTCAATAT
ACGACTTTTTTTTTCATCGGGACCTTTATATCCTTATCGTTTTATGAATATTTTTTTTTTAAATATATATTTAAATCAAAAGCATTTGATAACTTATTTTTTTATTTTCCAAAACAGAAT
TTAATTTAAAAAGTTTAATAACATGTAAATCATAGTTATCAAGTATAAAGAATGTGGCGTAGAAATTTTGTCTGCTTGGGTGACCTCTATAATACTAGATAGTAGATACAATATCTCTTT
TTTATAACAACCGCTCCGCAACGGGTTCGAAATGTAGATAAAAATAAGCAATTCGTGAGAGTTAAAGTTGTTTGATGTTTTAGTTAAGGGGCTAAACATGTCATTACTAAAGTTGTGGGA
CTACACATGTCTTAATTAAAGCTGAGGGGCTAAAGTTGTTTGATGTAGTTAAGTAGCTAAACATGTCATTACTAAAGTTGAGGGACTAAAGTTTTATAGTTAAAGGGCTGAACATGTCAT
TACCAAAGTTGAGGGGCTAAACCTGTCATTATTAAAGTTGAGGGGCTAAAGTTGATTAATGCCAAAGTTGGTTGATGTGAGTATGTGACATAATAGCATATTTATATAGTATATATAATA
TAAACCTTGTATTAATTTGTAACCATCTTCATATGTTCAATTTAAAATTTATTGGTAAGGATCATGAATGGAGGCAAGCAATAACTGCAGCTGGATCAGGATGCGTTGCTGCGCTCTCAG
TGGAAAGATATCTTGTCGGCAATAATCTTCTTATTGAATTTCACCAG
GTATTTACCAAAACTAGTTTATTATCATTTACATGAAAATGAACGTATAAAATGGTCAATAACTTACATTTAA
CCTTTATATCTTGTGATTTTTACAGCCACATACTGAAGAAGTTAAGAAAGAGCTCACGCCAAGAGACGTACAGGAAGGATTTGACATTTCGCTTACTAAGCACAGGGGCCAGGTATTTAA
AATGGGCGTCTTCATATATATCCACATAAAAGTTTGAAATTTATTATATGTTATGAGTTTTTATACATTTACCCTTTTAAACACTCAAAATAACATATTTACCCCTTGCATGGTAAATAA
TGTAAAATAATGCTATGTGTTGAGATGTTTCACAATAATAAAGTTGTTTTCCTGTTTGTTTATTCAGTAACTAGGTTAGAAACCTGTCTATTACACGGGTGAATCAAAGAAATATTAAAT
AGTCAGTAATGGAGATTTTGAATCTGTAAAAGACAAGATATGATTGAAATTACATATAAGAGTGAATTTCAAGTTTTGTCCTTTATCTTTAGGCCACTTTGCAAGTTTTGTCCTTTATGT
TTAAATTTGACGAGTTTTGTCCTTTATGTTTAAAAATTAAGCACGTTTTGTCCTTTATGCTTGATTTTTAAGGACAAAACGTGCTTGATTTTTTAAACATAAAGGACAAAACGTGTTTGA
TTTTTAAACATAAAGGGTAAAACGTGCTTGATTTTTAAACATAAAGGACAAAACTCGTCAAATTTAAACATAAAGGACAAAACTTGCAAAATGACCTAAAGATAAGGGACAAAACTTGCA
ATTCACTCTACATATAATAACCACTTTAAGTAAGAAAGCAATGGTATTGAAAATGATGGGGCAAAATAAGAGAAACGAGAAAAAGTATCTTGAGGTCACAGAGTTGTGACACGTGACGCA
ACCAAATACTTTTTTTACAAATGACTTATTTTATTTTATTTACAGTTAAACATGAGATTTTGTGTTTGGAATGGGTAAACATGATATTATGAATGTGATGCTGCTGGTTTTTCTTTTTTA
CTTTCGTCAGGATATCTTTCATTTTTTTACATCAGTTATTTTGGCTCCATTTCCTTTTCATGCAGTATGCATTGCGAAAATTGTATCACGAAAGTCCTAGACTCATTTGTGTACTATATA
CATCACCAACCTGCGGTCCATGTAGGACATTAAAGCCAATTTTGGGAAAG
GTAATGTTAATCCTTTTCGTATTTATATATTTTTTCTTATGTTAACTTTTGATCTGATGTGGACTAATAT
TATTAAACTTTAATTAATGGCAGGTTATAGATGAGTTTGATCAGAATGTTCATTTTGTTGAGATCGATATTGAAGAAGATCCCGAGGTTGCTGAAGCCGCAAATGTTATGGGTACACCAT
GTGTACAGTTCTTTAAGAACAAAGAAATGATCAG
GTTTGTAGTTTCCTTTTTTTTCTTTTAAGGGGCAATTACATATGAAGTTATGTGTTATTTCACTATTATCTGAAACAACTTATTCA
CAAGTGAATGGGTCGAAATGCGTCTAGTGTTGTTAACTTAATCTGTGATACGTTATTACATATATGAATGAATATGCAGGACTGTATCAGGGGTGAAAATGAAGAAAGAGTACAGAGAAT
TTATTGAAGCAAATAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACAACTACTGCTCAGATTGCCAATGGCGTCGGCATCCGTAACTCCGGCCGCCCTACCTCCGCCGCTCCCTCCACTCCTGCTCTCACTTCAAACAGCATCTTACTCAGTTTCACT
CGTCCACGCGCCTCCACGCTTCGTTTTCACTCCGTAGTTAACTTCGCCGGTCGCTTCTCTGCCTTCCGTCGTTCTCCGCCGCCGTGTTCCTTACGCGCCTCCGCTTCATCCGCCGAACAG
CCTACATCTTCAG
GGCAAGATGTTGAAAATTTGGTAATCATAGGATCGGGTCCCGCGGGATACACAGCAGCCATTTATGCAGCGCGTGCGAATTTGAAGCCTGTAGTGTTTGAGGGGTAT
CAAGTTGGCGGTGTTCCTGGTGGACAATTGATGACCACCACTGAAGTGGAGAACTTTCCAGGTTTCCCGGAGGGAATTACTGGTCCAGACTTGATGGATAG
GATGCGCCGTCAAGCTGAG
CGTTGGGGAGCAGAACTTCATCAGGAGGATGTAGAATTTATTGATGCGAATAACCGTCCTTTTACTGTGCAAAGCACTGACCGCAAG
GTGAAATGCCATAGTATTATAGTAGCTACAGGA
GCAACTGCCAAAAGATTGAATTTACCTCGCGAAGATGAGTTTTGGAGTAGGGGAATCAGTGCATGCGCAATTTGTGATGGAGCTTCACCGCTTTTCAAGGGTCAAGTTCTTGCAGTTGTT
GGTGGAGGTGATACAGCTACTGAGGAAGCAATATATTTGACTAAATACGCTCGACATGTTCATTTACTTGTACGCAGGGACCAAATGAGGGCATCGAAAGCTATGCAAGATAGGTTA
GTT
GATTCTGGCGAATGTTTCAGAGTTCTTGACAATCCAAATATCACAGTGCACTACAACACAGAGACGGTGGATGTTGTCAGCAACACAAAAGGACAAATGTCTGGCATAAAACTCAAGAAA
CTTGATACCGGTGAGGAATCAGTGCTGGAAGCTAAGGGCTTGTTCTATGGAATCGGTCATACCCCAAACAGCCAGTTGTTACAAGGTCAAATTGACCTTGATAGCGCCGGTTATATATTG
GTCAAAGATGGAAGTGCAGAGACTTCCTTAGAAGGTGTGTTTGCTGCTGGAGATGTTCAG
GATCATGAATGGAGGCAAGCAATAACTGCAGCTGGATCAGGATGCGTTGCTGCGCTCTCA
GTGGAAAGATATCTTGTCGGCAATAATCTTCTTATTGAATTTCACCAG
CCACATACTGAAGAAGTTAAGAAAGAGCTCACGCCAAGAGACGTACAGGAAGGATTTGACATTTCGCTTACT
AAGCACAGGGGCCAG
TATGCATTGCGAAAATTGTATCACGAAAGTCCTAGACTCATTTGTGTACTATATACATCACCAACCTGCGGTCCATGTAGGACATTAAAGCCAATTTTGGGAAAG
GTTATAGATGAGTTTGATCAGAATGTTCATTTTGTTGAGATCGATATTGAAGAAGATCCCGAGGTTGCTGAAGCCGCAAATGTTATGGGTACACCATGTGTACAGTTCTTTAAGAACAAA
GAAATGATCAG
GACTGTATCAGGGGTGAAAATGAAGAAAGAGTACAGAGAATTTATTGAAGCAAATAAGTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATAAACAAAC AAATAGATAA ACAAATAAAT AAACACACAC ACGTACAAAC AGTGGTTGTA GGTGCAGTTA TTTGTGGGTT GTGTTGAGGC CTGAGGGGAT ATTGTATTGT ATGGTCCGAA  ACCAATGGCT ACAACTACTG CTCAGATTGC CAATGGCGTC GGCATCCGTA ACTCCGGCCG CCCTACCTCC GCCGCTCCCT CCACTCCTGC TCTCACTTCA AACAGCATCT TACTCAGTTT  CACTCGTCCA CGCGCCTCCA CGCTTCGTTT TCACTCCGTA GTTAACTTCG CCGGTCGCTT CTCTGCCTTC CGTCGTTCTC CGCCGCCGTG TTCCTTACGC GCCTCCGCTT CATCCGCCGA  ACAGCCTACA TCTTCAGGGC AAGATGTTGA AAATTTGGTA ATCATAGGAT CGGGTCCCGC GGGATACACA GCAGCCATTT ATGCAGCGCG TGCGAATTTG AAGCCTGTAG TGTTTGAGGG  GTATCAAGTT GGCGGTGTTC CTGGTGGACA ATTGATGACC ACCACTGAAG TGGAGAACTT TCCAGGTTTC CCGGAGGGAA TTACTGGTCC AGACTTGATG GATAGGATGC GCCGTCAAGC  TGAGCGTTGG GGAGCAGAAC TTCATCAGGA GGATGTAGAA TTTATTGATG CGAATAACCG TCCTTTTACT GTGCAAAGCA CTGACCGCAA GGTGAAATGC CATAGTATTA TAGTAGCTAC  AGGAGCAACT GCCAAAAGAT TGAATTTACC TCGCGAAGAT GAGTTTTGGA GTAGGGGAAT CAGTGCATGC GCAATTTGTG ATGGAGCTTC ACCGCTTTTC AAGGGTCAAG TTCTTGCAGT  TGTTGGTGGA GGTGATACAG CTACTGAGGA AGCAATATAT TTGACTAAAT ACGCTCGACA TGTTCATTTA CTTGTACGCA GGGACCAAAT GAGGGCATCG AAAGCTATGC AAGATAGGTT  AGTTGATTCT GGCGAATGTT TCAGAGTTCT TGACAATCCA AATATCACAG TGCACTACAA CACAGAGACG GTGGATGTTG TCAGCAACAC AAAAGGACAA ATGTCTGGCA TAAAACTCAA  GAAACTTGAT ACCGGTGAGG AATCAGTGCT GGAAGCTAAG GGCTTGTTCT ATGGAATCGG TCATACCCCA AACAGCCAGT TGTTACAAGG TCAAATTGAC CTTGATAGCG CCGGTTATAT  ATTGGTCAAA GATGGAAGTG CAGAGACTTC CTTAGAAGGT GTGTTTGCTG CTGGAGATGT TCAGGATCAT GAATGGAGGC AAGCAATAAC TGCAGCTGGA TCAGGATGCG TTGCTGCGCT  CTCAGTGGAA AGATATCTTG TCGGCAATAA TCTTCTTATT GAATTTCACC AGCCACATAC TGAAGAAGTT AAGAAAGAGC TCACGCCAAG AGACGTACAG GAAGGATTTG ACATTTCGCT  TACTAAGCAC AGGGGCCAGT ATGCATTGCG AAAATTGTAT CACGAAAGTC CTAGACTCAT TTGTGTACTA TATACATCAC CAACCTGCGG TCCATGTAGG ACATTAAAGC CAATTTTGGG  AAAGGTTATA GATGAGTTTG ATCAGAATGT TCATTTTGTT GAGATCGATA TTGAAGAAGA TCCCGAGGTT GCTGAAGCCG CAAATGTTAT GGGTACACCA TGTGTACAGT TCTTTAAGAA  CAAAGAAATG ATCAGGACTG TATCAGGGGT GAAAATGAAG AAAGAGTACA GAGAATTTAT TGAAGCAAAT AAGTGAGTTT TTCCTTATTT CTCCTTACAC TAGCTCATGT TGTCATTTTG  TGTTTCAATT TTGATATTGC AAATTGGCTA GTTAAATACT TCCTTGTATT TTTTTAATAT ATCTACTGAT TAAGTAACTT CATCGCGATA TAGTGTATTA TATTGCAATG CAGCTTTAAA  AAATGTGATA TTCGATTTTG AATTCAAGAA AAGAGATTTG AGTTTTTGGT TGTTACATGT ATAGAGATCG GAATTTCCGA CATGCCAACA GCTTTAGACT TTAGGTAGCG TTTGGTATGC 
AGGAATGAGA GGTGGAATGG AGTGGACCAT TGTGAGGGAA TGAAGAAAAG AGTGTTTGGT TG 

Retrieve as FASTA