Entry information : HaTrxH03 (HanXRQChr08g0220871)
Entry ID 14499
Creation 2017-11-03 (Christophe Dunand)
Last sequence changes 2017-11-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaTrxH03 (HanXRQChr08g0220871)
Name (synonym) HaTrxH03 (HanXRQChr08g0220871)
Class Thioredoxin Type H    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaTrxH03
start..stop
S start..stop
ThasTrxF02 195 1e-63 123..245 59..179
AtTrxF02 195 1e-63 115..245 57..185
ThasTrxF01 195 2e-63 123..245 60..180
AtTrxF01 188 5e-61 124..245 56..175
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46606256..46606758 503 N° 2 46604896..46604995 100 N° 3 46604165..46604299 135  
complement(join(46604165..46604299,46604896..46604995,46606256..46606758))


exon

Literature and cross-references HaTrxH03 (HanXRQChr08g0220871)
DNA ref. HanXRQ genome:   HanXRQChr08 (46606758..46604165)
Protein sequence: HaTrxH03 (HanXRQChr08g0220871)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   245
PWM (Da):   %s   26956.14  
PI (pH):   %s   10.28
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATTHKFSTQITHISPPSNQPNPRVTPSFHTRYHIITYQPSNIQNTLTHNRLPPTTTTTTTTMALQIHHVCRPISPPSPSPPPSLSPSSWPTKQSNIVGEVRRSFNLVKTTSSKTANKLRNLTVRSSLEASGTAVVVGVVTEVDKDTFWPIVNAAGDKTVVLDMYTQWCGPCKIIAPRFQELAEKNLDVVFLKLDCNQENPLAKELGIKVVPTFKILKHGKIVKEVTGAKFDNLVAAMEEVRSS*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACCACACATAAATTCTCTACCCAAATCACCCACATATCTCCCCCATCAAATCAACCAAACCCAAGGGTAACTCCGTCCTTTCACACCAGATATCATATTATCACTTATCAACCA
TCTAACATCCAAAACACACTCACTCATAACCGTCTTCCACCAACCACAACCACAACCACCACTACAATGGCGTTACAAATTCATCACGTCTGCCGCCCTATTTCACCGCCGTCACCGTCA
CCGCCGCCCTCGCTATCACCGTCGTCATGGCCGACTAAGCAATCGAACATCGTCGGAGAAGTTCGCCGGTCGTTCAATCTAGTGAAAACGACGAGTAGTAAAACCGCCAACAAATTGAGG
AATTTGACGGTGAGATCGAGTTTGGAAGCCTCTGGTACGGCGGTGGTTGTCGGTGTGGTTACGGAGGTCGATAAGGATACGTTTTGGCCGATCGTTAATGCCGCCGGTGATAAGACTGTT
GTTCTCGATATGTACACTCAGTG
GTAAATTAGTTATTATTTGCTTATATTGCATTTTTCTGTTAGTTTAGTTGTTGATTGTTAAGAATTAGTTGCAGATCTGGAAAGTAGAATTCACTTA
TTGTGAAATTAAGTTTAGTAGAGTGTTTCAGTTTGGGAATAATTTAGTAGAATTAATAATTTATAATTATATGTAAGAAATTTTGCATGATCGCTAGTCAATTTGAACTATGAAAGTAGG
AAATTAGTGTATCTCTTAGGTCAGTTCAATAAGATGCTATAGATACAAACTTAATTACTTTAAACATTATATTGTGTTATACTTTACTAGTTTACTATATAGGTTCCATAGTTTACATGA
CAGCTATGTTCATAAAAGTGTGAGGTGCTAAGAGGTTCTTAGGTCTCGAAAGCTGGGACGCGAGTTTCACATACGCGAGGTGTTGCTCTCCGTACAAGCCAAAATAAGCTTTATGTGTTG
GACAGGAATTAATCACCAGGAACAAAACAACACAGAGTTGTTCTGATTGAATCAGGAACAAGATTAGAAACAATGGAACAATGAGTGTTTAGAGAATACATAAACTTTAGTAAACAGTAA
GGACTGATATATTTCTAGGAGATTGATTCACTATGTACATACATAGGGGACGGTTTTGGTGGAAGGGACACAACGCTTCGAAAACGGATGCAACCCTAATCTGGATTACAAACTTGAAGC
ATAACTTATATACTTAGATCTTAGTGTTTTATATAATTACAACTAGATCCATACATTAACACATATACTTGACTTTTCTTTTTGACATTTCTTTCTCCTGTTCTTTATTACTGTGTTGGG
ATAACTTATGTATGAATGATATTTATGTTAGCATTTTTTTATACTTATATTTGTGGCAACTTCTAATTGGCAATATCTTGGGCAATATCTTGTAAGGTATCTCCTCCACCCAAAAAACAG
TAAATCTTGACTTCTGAACATCTTTTTACTTGGTTTGAACAGTAAAAAATTGATCCATTTGGAAAAGATTTTTTATACAAAATCTTTCATTAGACATGCAATTCATCCTAACTTTCTCGT
ATGAGAGGGTAAACGTATGGTGTGCACGAGTATTGTTTGAATCCGACTTGATTATTGTAATTTTTTTTCTTGGTAAACAGTTGTATGAGACATGGTTTTATTTGTTAATTATAATTATAA
CATAACCGTATGTGTAATGGTGTTTATGTAATCAGTGTGGTTTTATATTGTTCACGGTTTCTGATTTGTTTGGATCTTGATAGGTGCGGTCCTTGCAAGATAATCGCGCCAAGGTTCCAA
GAATTGGCTGAGAAGAATCTTGATGTTGTATTTCTAAAGCTTGACTGCAATCAAGAAAATAAG
GTATAGTTGTTTTATAATATTCCAAGAAGTGTATGTATACCACCAATATTACTATTT
AGACTATCAATCAAGCTATGAAGTTTTTTAAAGTTATTGTATGTTTCAAACAAGTTCTTAAATATAATAACTTCTTTTGTTTTGTTTTGTTTTCTATACGTATAGTAACCGAGGTTTACT
AGAGTTCTCTCTTTTTGCAGCTCACCCTGTTTGATATATAACATTTTTCTTTTTTTCCCGATTTTCATTTAAGATATAACTTAGCTTTTATCTTAGTATCTAATATATAAATTTAAATAT
ACTGTTATGTTCAGACGGAGTTACTTTTCCATTAAAGTGGGATTGACCATAGTGACGAAAATGAAAGTTAGGAACCAGTATGAATTATTATTGGCTAACGGGTCATAGCTTGGATTACTA
AAATCCAAATCGCCTAATTGTCTTTATCTTCGATATATTTATATGTTTTTTGAAAAAACTGAGTTATCCATCATAAAGTATTTTTCTGCATAACTGACAAAAAGAAAAAACCGATAGAAT
TGATTTTGATATCATTTTGTATGACTTCTGGTGGTAATATTATTGATATGTGTTGGCAGCCATTGGCAAAGGAGCTAGGCATAAAGGTGGTCCCTACCTTCAAGATCCTTAAACATGGTA
AAATTGTAAAAGAAGTTACTGGGGCTAAGTTTGATAACTTGGTTGCAGCCATGGAGGAAGTTAGATCCAGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACCACACATAAATTCTCTACCCAAATCACCCACATATCTCCCCCATCAAATCAACCAAACCCAAGGGTAACTCCGTCCTTTCACACCAGATATCATATTATCACTTATCAACCA
TCTAACATCCAAAACACACTCACTCATAACCGTCTTCCACCAACCACAACCACAACCACCACTACAATGGCGTTACAAATTCATCACGTCTGCCGCCCTATTTCACCGCCGTCACCGTCA
CCGCCGCCCTCGCTATCACCGTCGTCATGGCCGACTAAGCAATCGAACATCGTCGGAGAAGTTCGCCGGTCGTTCAATCTAGTGAAAACGACGAGTAGTAAAACCGCCAACAAATTGAGG
AATTTGACGGTGAGATCGAGTTTGGAAGCCTCTGGTACGGCGGTGGTTGTCGGTGTGGTTACGGAGGTCGATAAGGATACGTTTTGGCCGATCGTTAATGCCGCCGGTGATAAGACTGTT
GTTCTCGATATGTACACTCAGTG
GTGCGGTCCTTGCAAGATAATCGCGCCAAGGTTCCAAGAATTGGCTGAGAAGAATCTTGATGTTGTATTTCTAAAGCTTGACTGCAATCAAGAAAAT
AAG
CCATTGGCAAAGGAGCTAGGCATAAAGGTGGTCCCTACCTTCAAGATCCTTAAACATGGTAAAATTGTAAAAGAAGTTACTGGGGCTAAGTTTGATAACTTGGTTGCAGCCATGGAG
GAAGTTAGATCCAGTTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACCA CACATAAATT CTCTACCCAA ATCACCCACA TATCTCCCCC ATCAAATCAA CCAAACCCAA GGGTAACTCC GTCCTTTCAC ACCAGATATC ATATTATCAC TTATCAACCA  TCTAACATCC AAAACACACT CACTCATAAC CGTCTTCCAC CAACCACAAC CACAACCACC ACTACAATGG CGTTACAAAT TCATCACGTC TGCCGCCCTA TTTCACCGCC GTCACCGTCA  CCGCCGCCCT CGCTATCACC GTCGTCATGG CCGACTAAGC AATCGAACAT CGTCGGAGAA GTTCGCCGGT CGTTCAATCT AGTGAAAACG ACGAGTAGTA AAACCGCCAA CAAATTGAGG  AATTTGACGG TGAGATCGAG TTTGGAAGCC TCTGGTACGG CGGTGGTTGT CGGTGTGGTT ACGGAGGTCG ATAAGGATAC GTTTTGGCCG ATCGTTAATG CCGCCGGTGA TAAGACTGTT  GTTCTCGATA TGTACACTCA GTGGTGCGGT CCTTGCAAGA TAATCGCGCC AAGGTTCCAA GAATTGGCTG AGAAGAATCT TGATGTTGTA TTTCTAAAGC TTGACTGCAA TCAAGAAAAT  AAGCCATTGG CAAAGGAGCT AGGCATAAAG GTGGTCCCTA CCTTCAAGAT CCTTAAACAT GGTAAAATTG TAAAAGAAGT TACTGGGGCT AAGTTTGATA ACTTGGTTGC AGCCATGGAG  GAAGTTAGAT CCAGTTAGAC AAAACTTAAA CCCATCTGTC TATAAGTACT AATTTATATG TTTCAAATTA AACTATAAAT AACTATCAAC CATGCTCAAG TGTTCGTTCT AGCCTTTCTA  TGAACACTGA AATAAGCGAC CCCGACTGGA CTTTCCAGGT TGTGCGTGTT TGCAAAGTCA TGGGTACTGA AACAAGCGAC CCCGACGGTC CATATGAGCT AGGAGCTCGT CATGTTCACC  TCTTGTGAGA ATCATGTAAT TTCAGCAAGG CCCACTCTAA GTTTGGAACC ATTGATCAAC CTATGGTTAC CGCCATATAT AACCGTTAGG CATTAGGCTA CGAGATATCT ATATTTTTTA 
TCTTACCCAT CCTACAACTC TCTCTCCTTT ATGTAAAAAA GTATTAAATT A 

Retrieve as FASTA