Entry information : HaTrxH07 (HanXRQChr14g0449391)
Entry ID 14503
Creation 2017-11-03 (Christophe Dunand)
Last sequence changes 2017-11-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaTrxH07 (HanXRQChr14g0449391)
Name (synonym) HaTrxH07 (HanXRQChr14g0449391)
Class Thioredoxin Type H    [Orthogroup: TrxH004]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaTrxH07
start..stop
S start..stop
AtTrxH02 174 1e-57 1..134 1..133
ThasTrxH02-1 171 1e-56 1..135 1..132
ThasTrxH02-2 168 3e-55 1..133 1..130
HaTrxH02 142 5e-45 22..133 11..122
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 137985914..137986186 273 N° 2 137984490..137984639 150  
complement(join(137984490..137984639,137985914..137986186))


exon

Literature and cross-references HaTrxH07 (HanXRQChr14g0449391)
DNA ref. HanXRQ genome:   HanXRQChr14 (137986186..137984490)
Protein sequence: HaTrxH07 (HanXRQChr14g0449391)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   140
PWM (Da):   %s   15708.93  
PI (pH):   %s   6.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSVLSSFWGESEQTPNDGDASSGESRVIEFHSSNRWQLHYNESKQSPKLMVVDFSASWCGPCKMLEPFIRSLSSKYPEIDFIKIDVDELQDVAQQFGVQAMPTLVLLKQGKEVERVIGAKKDELEKKILKHRATPKFAA*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATCGGTGTTATCATCGTTTTGGGGAGAATCTGAACAAACTCCCAACGACGGCGATGCATCATCGGGCGAATCACGAGTCATCGAATTTCATTCTTCTAACCGCTGGCAACTCCAT
TACAATGAGTCCAAACAGTCCCCTAAACTCATGGTGGTTGATTTCTCAGCCTCATGGTGTGGACCTTGCAAGATGCTAGAGCCCTTTATACGCTCCCTCTCTTCTAAATATCCAGAAATC
GACTTCATCAAGATCGATGTTGATGAATTACAG
GTATATTTCTTTTATTATTTGTCATCTGGTAGGACTGTTTTTTTGTGAATTCATTGTTCAATTCACCATGTTATTGTAATCAACTAG
TGTTAAATTTAGGGATTAGGATTAGGCCTATCAGTTTCACAAAGAAAAAAAAACCCTAATTTGATTTTGATTTCGTATTAAATTGGACTTATGGGACTGGAATTTGAGGTTGATTGTATC
TAAATTTTAACCAATTTTGCTTCAATTCCAATTCCGTGTCTTCGAAATTGGAGCTTCCATCAGTGATCTTTGTTACAGCTAGGGTGCAAACAGGCCAAGTTGAGCCCAAGCTCAACTAGG
CTCTAGCTCGTTTAACTTATGGAACCTCAAACTCAAGCTTTGTTTCTAGACAATGGAAGCTTTTATTGTAGTTTGGGTATTTTTACTTAATTATAATTATTTTTTATATGTAATTTAGCT
ATGTTTATCATAATTTTATCATCATCATCATCATCATACTCGGTATATCCCACCAATAGCAAAGCTAAGGTAGGGTCTCACGAGGGTAAGATGTAGACAACCTTACCTCTACCCCGTAGG
AATAGAGAGGGTGCTTATAGTGAGACCCCGCTCGATAGTAGTTTTGCATCAAGCCTTGGACATAAGGCACATAACGCTCAACAATTGAGACAAACGCCAATTAGTGCATGTACCCCTTGT
CTTTCGGCTATCAACGCCAGCACATGATGCATGATTAACCATCCCCTTTTTTAACGTTATTTGCACGAAATTAGTAAAATAACGTTAAAATTAGAGCACTTCCACTTTTGCCCCCGAGCA
CCCACACACATATATATATATATTATATGAGCATACCGCAAGCGGGGTTTTTTTTTCATAATTTTATAAATTTAATAATTATTATTTAAATATATATTTAATATATTGTTTAAAAATTAT
ATAAACAGTGGGCTCGTTTAGGCTCGCAAGCTGGCTTAAGCTTGGTTTAGGCTCGGGCGCTTGGCTCATTTCAAACATCTTTTTCTAGCCGAGCTCGAGTAGCTCGTGAGTAGTTGTACT
CGCTTGCACCCCTAGTTACAGCCTTATCAGGAGAACTCATCCCAAAAGACTAGTATGGTGGGTGAGGAGCCCATTTGGTCTATAAACTCCACATTTGTTGCCCAAACAATTGATGTGAGA
CAAGACTCATATTTTGCGATAGTTTCAGTTTGTAACAATCTTGTTGGAATCAGAAAGGTTGTTGAGTTTTAATGATTTAAGAATTTAAGATAAATGGATGATTGCAGGATGTTGCGCAGC
AGTTTGGGGTGCAGGCAATGCCTACACTTGTGTTGCTGAAACAAGGGAAAGAGGTGGAAAGGGTTATTGGTGCTAAGAAGGATGAACTGGAGAAGAAGATCCTTAAGCACAGGGCAACTC
CTAAGTTTGCTGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATCGGTGTTATCATCGTTTTGGGGAGAATCTGAACAAACTCCCAACGACGGCGATGCATCATCGGGCGAATCACGAGTCATCGAATTTCATTCTTCTAACCGCTGGCAACTCCAT
TACAATGAGTCCAAACAGTCCCCTAAACTCATGGTGGTTGATTTCTCAGCCTCATGGTGTGGACCTTGCAAGATGCTAGAGCCCTTTATACGCTCCCTCTCTTCTAAATATCCAGAAATC
GACTTCATCAAGATCGATGTTGATGAATTACAG
GATGTTGCGCAGCAGTTTGGGGTGCAGGCAATGCCTACACTTGTGTTGCTGAAACAAGGGAAAGAGGTGGAAAGGGTTATTGGTGCT
AAGAAGGATGAACTGGAGAAGAAGATCCTTAAGCACAGGGCAACTCCTAAGTTTGCTGCTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTGCGGGTTC TTAACTAACG GTGGACTTTG GAGTTACTTT TCTCCCTTTC CGGTATTCCC TATGTATACG TTTCCCACAA GGAATAAAAC ATGTCAAAAA AGTAAGTCAA AGGGACTATA  TATATATATG CAACTCAACC TGATCTGTAG CGTACATTAT ACAACATCAA AATCAAAGCT CACATAAAAC CGTCCGCATA CCTTTCTCTC CAGATACCGT TGTTGTTGTG TGCAGATATG  GGATCGGTGT TATCATCGTT TTGGGGAGAA TCTGAACAAA CTCCCAACGA CGGCGATGCA TCATCGGGCG AATCACGAGT CATCGAATTT CATTCTTCTA ACCGCTGGCA ACTCCATTAC  AATGAGTCCA AACAGTCCCC TAAACTCATG GTGGTTGATT TCTCAGCCTC ATGGTGTGGA CCTTGCAAGA TGCTAGAGCC CTTTATACGC TCCCTCTCTT CTAAATATCC AGAAATCGAC  TTCATCAAGA TCGATGTTGA TGAATTACAG GATGTTGCGC AGCAGTTTGG GGTGCAGGCA ATGCCTACAC TTGTGTTGCT GAAACAAGGG AAAGAGGTGG AAAGGGTTAT TGGTGCTAAG  AAGGATGAAC TGGAGAAGAA GATCCTTAAG CACAGGGCAA CTCCTAAGTT TGCTGCTTAA TCTATCAAGT GTTTGATTGT GTTGAGAAAA CTTGAAACTT ATTTGGGCAA GTGAAATCTG  AATTGTGTCA AATAAAGTGG TCTTCTGTAT GAACTGCTTA AATATTTATG GTGTTGGTTT ATGTATTTTT ACTGATACTA GTTAATTACT TGATATGATT CATGTTGTCG CGCAGATCTT  TGATTGTGTA TCTATTCTCG CTCGTGTGTC TATGTTTACT ATGCTAAATC TAAATGTTTT CATTCTAATA TGCAAATGAT AATACATTGC TATGGGAAAA ATTCGGATAC ACGATGAAAA  GTAGATACAA AATGGGTGGC TTGTTTCTGA CTTGGCTATA TATGTGTATA ATGCACCCAA TAAATTGATT ATTTTCATGA TTTTCTTGTC TTATAGGCTT GTTTGTGAGC ATAGCAAACA  CTACAGACTT GTATGATTGT GTGCATCAAC AAAATGTTAG AATTTTAATA ACTCAAAAAG AAATCTATGC TTCTATACTG TAGGGATGAG CAAACGGTTA CCGGTACCGA ATTTAGCGAA 
CCGGGTACGT TTTCGGTACC GACTTTTGAC ATTTTCGGTA CCGATCTGGT ACAGTACCG 

Retrieve as FASTA