Entry information : HaTrxM05HanXRQChr11g0331381
Entry ID 14510
Creation 2017-11-03 (Christophe Dunand)
Last sequence changes 2017-11-03 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaTrxM05HanXRQChr11g0331381
Name HaTrxM05HanXRQChr11g0331381
Class Thioredoxin Type M    [Orthogroup: TrxM003]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaTrxM05
start..stop
S start..stop
AtTrxM03 174 1e-56 58..167 64..174
HaTrxM07 171 2e-55 7..167 17..161
ThasTrxM03 168 4e-54 62..167 77..182
HaTrxM06 131 6e-40 5..165 13..163
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49274271..49274454 184 N° 2 49275761..49276086 326  
join(49274271..49274454,49275761..49276086)


exon

Literature and cross-references HaTrxM05HanXRQChr11g0331381
DNA ref. HanXRQ genome:   HanXRQChr11 (49274271..49276086)
Protein sequence: HaTrxM05HanXRQChr11g0331381
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   169
PWM (Da):   %s   18440.31  
PI (pH):   %s   8.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANSSSSVLPSSSSSSHLNTQFALRSSLFASPLHNNNGFSFRPIKTKSPVRVLSMQQRPSKATVVTGQSWNTSVLESKTPVLVEFYASWCGPCQMVHRVIDEIAAEYAGKVNCYVLNADKDPRITEEYDIKAVPIVVLFKNGEKCESVVGTMPKEFYVAAIERVLSSSS

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAATTCATCTTCTTCTGTTTTACCTTCTTCTTCTTCTTCTTCTCATCTTAACACCCAATTCGCATTACGATCTTCACTGTTTGCATCCCCTCTGCACAATAATAATGGCTTCTCG
TTCCGTCCGATCAAAACCAAATCACCTGTTCGAGTCCTCTCTATGCAACAACGCCCATCTAAAG
GTACTTTTCATTTCTATGTTTAATAACATCTTATTGCGCCAGTTTTTTTATGGTTT
ATTGGCGGGATCGTATTTTATTAAGATTTCCTGAATCAGAGTGGGATCGAATCGAATTAGGGATTTTGTTTCCTAAAGTGATTAGTGATTTTTGTTTAGTATTTTGTTCCTTTTGAGTGT
ATGATTTGATAATTAATATGAAGATTTTATTGTTTATGTGGGCCAATTAATTGTGGTTTTAGCATGATTTTGTTATTGGTGATCGATCATATTTTTATTAGAGGGTTTTCTTGTTTTTTA
TTTTGCTAACTTGATAAGCATTGGTAGAATGTAGTTGACATTTATGACATTAAGGTCCAAGTTATTTAATATTTTGTGCATTTTGTGGTTACTCTTTATAGGCTGCTAAATAAAGAAATA
GCTCTACTTTCTTTATTTGGATTAAAGAAGCAAATCCACAAAACTATGGAAACTTTGTCAACAAATGTAATCTCTTAATTAGCTTTAACTAGAGAGAAAGCTTTCTATCCATGGCATTAT
AGCCTAGTGGCATCTTGGGATGGGATAAGGTTTTGGGACCATTAGGTCCTTGGTTCGATTCTCACAAAGGGGGATTTTTCCCAGATTTATTGGGTTTCCTCCTGAATTGGTGTATAGGCA
TTATAGCCTAGTGGAGATGGATATGATCGGGTGGTTCTGCTGGTGGCACGATGATACTCCAGTGGTCCGCCAGTGATCCTAATTTGCCGTTAAAAAAGAGAGAAAACTGTCTGTGGGATG
TAAAGATCAATGATGTGAGAAAATGATCAAAAAGGGTGTTTGGATTTATATTTTGAAACTGATTATTGCACCATTAAGAACTAGTTAATGTATAATCTGATTATTTCTTACATGTGAGCC
TCCGAATCTGGTTATTTTGACCCCTAAATAATCAGAAAACCGTGATTACCCCCAATTACTTACAACTGATGAAATGCACATCCAAACCCTCTCCGTGTTTAGTTATAGAGGTTACACATT
ATTCCCCTTGAATTGGTTAATAATAGGCTGATCTTGTTTAAGAAAGCACATACTTCAGATATAATCTTGCGGTGGGTGGGATTATGTAACCCCATCCATATTCCTGGAGATTTTATTCAG
ATTAGAAAATTTGTTTAGTTTAGTTATATCGGATGCCATTTTTTTGAAACACAAAACCGTATGTGATGCACTGTGAGCCGTTTGACTTTGACCGTTAAGGCCTAATTGCTTCGTTTCTAT
GATTATGAAATAAGCTGATCATGCGCTTCTATTTACATCTATAATTACAGCAACAGTGGTGACGGGGCAGTCATGGAACACATCAGTTCTCGAAAGCAAAACCCCAGTACTAGTTGAGTT
CTATGCCAGCTGGTGTGGACCATGCCAAATGGTGCACCGTGTGATCGATGAGATTGCAGCCGAATATGCAGGGAAGGTGAACTGTTACGTGCTAAACGCTGACAAGGACCCACGAATCAC
AGAGGAATACGACATCAAAGCGGTCCCAATAGTGGTTTTGTTCAAGAACGGTGAGAAGTGTGAGTCAGTGGTTGGGACCATGCCTAAAGAGTTCTATGTGGCTGCCATTGAAAGGGTCTT
GTCGTCTTCGTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAATTCATCTTCTTCTGTTTTACCTTCTTCTTCTTCTTCTTCTCATCTTAACACCCAATTCGCATTACGATCTTCACTGTTTGCATCCCCTCTGCACAATAATAATGGCTTCTCG
TTCCGTCCGATCAAAACCAAATCACCTGTTCGAGTCCTCTCTATGCAACAACGCCCATCTAAAG
CAACAGTGGTGACGGGGCAGTCATGGAACACATCAGTTCTCGAAAGCAAAACCCCA
GTACTAGTTGAGTTCTATGCCAGCTGGTGTGGACCATGCCAAATGGTGCACCGTGTGATCGATGAGATTGCAGCCGAATATGCAGGGAAGGTGAACTGTTACGTGCTAAACGCTGACAAG
GACCCACGAATCACAGAGGAATACGACATCAAAGCGGTCCCAATAGTGGTTTTGTTCAAGAACGGTGAGAAGTGTGAGTCAGTGGTTGGGACCATGCCTAAAGAGTTCTATGTGGCTGCC
ATTGAAAGGGTCTTGTCGTCTTCGTCTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATAGACCTC ATCTGTTTTG TTCTCCAGCT TCACTCTCAA CTCTCATTTT CAATAATAAT AATATCCACG TCATCACCCA TCAGATCTCT CTGATCAATC AATTCTTCCC TCAAACTCTT  TGTTTACAAA TGGCGAATTC ATCTTCTTCT GTTTTACCTT CTTCTTCTTC TTCTTCTCAT CTTAACACCC AATTCGCATT ACGATCTTCA CTGTTTGCAT CCCCTCTGCA CAATAATAAT  GGCTTCTCGT TCCGTCCGAT CAAAACCAAA TCACCTGTTC GAGTCCTCTC TATGCAACAA CGCCCATCTA AAGCAACAGT GGTGACGGGG CAGTCATGGA ACACATCAGT TCTCGAAAGC  AAAACCCCAG TACTAGTTGA GTTCTATGCC AGCTGGTGTG GACCATGCCA AATGGTGCAC CGTGTGATCG ATGAGATTGC AGCCGAATAT GCAGGGAAGG TGAACTGTTA CGTGCTAAAC  GCTGACAAGG ACCCACGAAT CACAGAGGAA TACGACATCA AAGCGGTCCC AATAGTGGTT TTGTTCAAGA ACGGTGAGAA GTGTGAGTCA GTGGTTGGGA CCATGCCTAA AGAGTTCTAT  GTGGCTGCCA TTGAAAGGGT CTTGTCGTCT TCGTCTTGAA CTTTTTAAGG GGGTGTGTAA AGTTGTTTAG GTGGTTTGTG CTAGCTTCGT TTTCTGCTTA AATCTGAATT TGGACGATTT  TCTCATTGGC GGTTTAGGGT TGATAAGCGT TGATACAGAA ACGGTTTATT TTGCGACTAC AGTCGATGTG ACAAACTCAG GTTGGGGGTT GTGTTCTTAT AGAAAAATAA GGGTTATCAT  CTTTTAAAAT TTACATCATG AGTTGTTTTC TTTGTCAATG GTATGAAAAC ATTTCAGTTG CCACTTGCCA GTCTTTTTAA TATATTTTTT TATAGGAAAA ATTACAAGTT TATTGTTTGT  TTCTTCATCA ACTGATGCGC CTGGAACCGA GCAATCCAAG TTTATTCCAT CAAATCATGT CAGATGATAC CCGTCTCAAT AAAACACCGC CGTATGAAGA CATCGAAATC AAGCGTTTTC  ATCTTTCTTT AGATCCGTAT CTCATATTCG TATGAAGAAC CCGAACAAAC TGTACATAAA CGTCTACCCG TTTTGTTTTC CTCATACAAC CGGCTCAGCA TCTCTTTTTT CTGTACGATA  AATGATCAAA CCCACGTGTG CACCTGTTCA AGTTGGGACG GGACACCTGT GATAGCCTTA GCGGCCACCA ACACAACCGA ACCAAGTGAC GATTCTTCTT CGAACCCATG CTTAGGTGGA  ATTATGTAAA AAAGAACCTT GTATGGCAAC ACGTTAATTT GTTTAGCAAC CGGCAGCGAC CAAAAACTTC TTCTTGCTTA CCGGTTCTTC AAGAACCACA ACGACATCAT CCACCTTTTC  AAACAACTCC TCCAATTCAC TCACACCAAA CCTTTGAAAA TCCAACGCTC GTTTATACCT TTGCTGATAA ATCGCCTCAA AATACCCCAA AGATATCGTA CACGAATAAC TCACTAAAAT  CTCCTGAAGC TCAAACCTAA ACTTATCTAA ACTTTCATCT TGATCTTCCA AAACTACCCT TTCTTCATCC GAGAAGTCAT CACACGTATT CTCGTCCCGT ATACCCTTGC CTTTTCTATC  AATCTTTTCC GCAACCGAAG TGGTCCCCGC TAAACATTTC CTAAGATATA CAAACTTCCT TTGTCCCTTA CCTTCAACGG CTATTTTATC ACTCATTTTT CTCAAAAGAT TTACGAGTTT  CAACGTCCCG TATTCCGAAA CGTAAAGCGG TCTCCCGAAA CTTCTCTGGT ATTCAGCGGG AAGACGTGCA AGCTCCAAAC AACCGTTGAA ACATTCTAGA AGCTTAACGA GTTGACCCTT  TAAGCCGGTC AAATCTCCAG GCTGGACCCA CGTTATATCG TTGTTTAAAC CGCATGGAAG ACTATAAGAC CTTGATGTTG TTGAAAAATC TTTGGAACTA TAGTAGGTTC GAGATATTCC  TCTATAAACA ATCGCTTCTT CTTCGTTTTG AACATCTGAG CTGTCGGTTA TCTGACAGCT CATCAGTAAG CTCGCCATGT CAGCAGGACC CATACCGGTC CCACGAGCCG GAACAAACCC  TTCTCCACGA ACAACACTAG GCCAGTCCCA AACGAAACTA CCAGCGTTAC TCAACGCAGA CGAAACACCA ACACCGGACG GAATCACGAG AATTACGGTA TACCCGCGTT GACCAAGTAT  GTGAAGTGCG GGAGAAAAGT CAACATCACC GGAAATCAGC ATGATTGTAG ACGGTGGGGG ATTATCGAGA GCAAAAAGAA ACATGTCGAC TAATATCGCT TTATCCGCAG CATCTTTTCT  GCCGTTCGGT ACGTCTATGA GCTTGACACC TGTCCTTTGG CATCCTTCTC TGAGACGTCT AGGAAAGCCG TTGAAATCCC CGTAAGCGGA GAACATTGTT ACGGCACCGG TAATTATCGG  GTGGACCCGT AAGGCCATTC GGATGTTACT GGCCACATCT TCTGGCCGTA TGTCGCTAGG AACGGGACAG TTTTCCATGT CCCAGAGTAT GGCAATCGAC CCGTCTGACC CGTTACGGTT  TTGTTGAGGT GAGCTTGTGT TTTGGATGGA CAGTTGTGTT TGTTCCATGG ATCCTGAAGA TAATATCAAC GTTGATGCGT TTGTGCCGGC CATCAGTAGA TAACAAAAGC TTCAAGGGAC  CTGTTGATTT AAAAAAAAAT ATTTTTTTTT GTTATCCCTC TCAAATTTCA TATAGTGTCA ACCTATAATA TCCGAGTTCT ACGCATAAGC AAAACCACAA ATGCTACTTA AAATGCCCTA  GAATAATAAT CTAAGTGCAC CACAATCCTA CTCGAGTACC TGACAGATAA CTTGAAGCGA TCACCGTTAA CAATCAATCA TTTTTCAAAG TTCAAATTAC AGTAGGAACG CGAGAAGGCG  TTAAATACAA ATACTCTTAT GCATTTCATA TCATATAATC AGCAAGCAGC AATCACATAT TTGTCAACAA CTTAATATCT AAGGTCCAGA TTTTAACACT AATTGAAAAA CTAATGATAG  ATTCAATATA TATATGCTAC AAATAAATTG AACTAAATCC TCAATAAACC AAACGTGTAG AACACGAAAT CAATAAAATT AACACAACAT CGTGAAATCT AATAATCAAC GGTCAACGGG  TCAACCTAGC TATACGTTGG TGATAACCTA ATGAATTGAA ATCGAAAACA AACATCAAAT TCAGGCTTGA TAAATTGAAA TCAGTATTCA AAGTGTCCGA TTAACCTAGA AAACGAGAGA  AAATATATTC TAAACGTATA ACACCTTGAC ATGGATTCAA ATTTAAGATG AAAATCAAGA TAAACATTCA TAGATCTGCA ACCGAAGATA ACAAATTAAA TATGATTACA GAGGGAGAGA 
TTTGAAATTA CCTGCCGAAA GTAGAATGGT 

Retrieve as FASTA