Entry information : HaENODL11HanXRQChr11g0337901
Entry ID 14530
Creation 2017-11-07 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaENODL11HanXRQChr11g0337901
Name HaENODL11HanXRQChr11g0337901
Class Early nodulin    [Orthogroup: ENODL002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaENODL11
start..stop
S start..stop
HaENODL03 199 4e-66 7..182 17..185
HarENODL17 193 3e-63 7..183 4..210
HaENODL17 193 3e-63 7..183 4..210
AtENODL13 155 2e-48 8..189 13..202
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 89737920..89738085 166 N° 2 89738337..89738743 407  
join(89737920..89738085,89738337..89738743)


exon

Literature and cross-references HaENODL11HanXRQChr11g0337901
DNA ref. HanXRQ genome:   HanXRQChr11 (89737920..89738743)
Protein sequence: HaENODL11HanXRQChr11g0337901
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   190 (168)
PWM (Da):   %s   20199.89 (17857.6)  
PI (pH):   %s   4.59 (4.72) Peptide Signal:   %s   cut: 23 range:23-190
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANSFIVISVLSLLLLIQSNDAYEFLVGGSGDWSLASTNYNQWAEKSRFQIGDTVLFKYEAEKDSVVEVSKDDYNNCNAASPIAKYSDGHSMVKLNQSGPHYFISGLVENCKNNEKVVIVVMADRSKHHQSPPSSPPSPVPAVEELPSPPPAPATEDNNPTPAPSAASSAVMSFVCSVIAFAGSSALYVI

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAATTCATTCATCGTTATCAGTGTTTTAAGTCTTTTGTTGTTGATCCAGAGCAACGACGCATACGAGTTTTTGGTTGGAGGTTCTGGTGATTGGAGTCTTGCATCAACCAACTAT
AATCAATGGGCCGAAAAAAGCCGTTTCCAAATTGGTGACACCGTCT
GTAAGTTCATTCATTAAAAATTCAACTTTAAGTAAAAATTAACTGCAAAAACCAAATAAACAATTGCACCTTTA
CCTTAAAATGTGATGCATAAGACAGTTATATCTATCTCACATTATATCTGTCAAGCACTACGTATAAGTGTATTATATAGTTTTTAGTTCAACGTATCCTTGTATATATTAACTATTGCA
ATATTAATGATTGTGAGTTATTAAGTTAAGTTCTTACTATCTTTGTTCGGGTTGTAGTATTCAAATATGAAGCCGAGAAGGACTCGGTGGTTGAAGTGAGCAAAGATGATTACAACAATT
GCAACGCAGCATCACCCATTGCAAAGTATAGTGATGGTCACTCAATGGTCAAGTTGAACCAATCTGGACCTCATTATTTCATTAGTGGACTTGTTGAGAACTGCAAAAACAACGAGAAAG
TTGTGATTGTTGTCATGGCTGATCGAAGCAAACACCACCAATCGCCGCCAAGCTCACCACCGTCTCCAGTTCCAGCAGTTGAAGAGTTGCCATCTCCACCACCCGCTCCAGCAACAGAAG
ATAATAACCCGACTCCAGCCCCTAGTGCCGCTTCTTCAGCTGTCATGAGTTTCGTGTGTTCTGTCATTGCTTTTGCTGGCTCTTCTGCTCTTTATGTTATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAATTCATTCATCGTTATCAGTGTTTTAAGTCTTTTGTTGTTGATCCAGAGCAACGACGCATACGAGTTTTTGGTTGGAGGTTCTGGTGATTGGAGTCTTGCATCAACCAACTAT
AATCAATGGGCCGAAAAAAGCCGTTTCCAAATTGGTGACACCGTCT
TATTCAAATATGAAGCCGAGAAGGACTCGGTGGTTGAAGTGAGCAAAGATGATTACAACAATTGCAACGCAGCA
TCACCCATTGCAAAGTATAGTGATGGTCACTCAATGGTCAAGTTGAACCAATCTGGACCTCATTATTTCATTAGTGGACTTGTTGAGAACTGCAAAAACAACGAGAAAGTTGTGATTGTT
GTCATGGCTGATCGAAGCAAACACCACCAATCGCCGCCAAGCTCACCACCGTCTCCAGTTCCAGCAGTTGAAGAGTTGCCATCTCCACCACCCGCTCCAGCAACAGAAGATAATAACCCG
ACTCCAGCCCCTAGTGCCGCTTCTTCAGCTGTCATGAGTTTCGTGTGTTCTGTCATTGCTTTTGCTGGCTCTTCTGCTCTTTATGTTATTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAATATTCTT TGCACTCCCA CCTAAGAAAC CTCATTACAA CCAAAAGCTT CTTCTACAAA TACCCAAATC ATATCTTAGA TCCTCCTCAC CTTCAAATTC TTGTGAACAT TTTCAATGGC  GAATTCATTC ATCGTTATCA GTGTTTTAAG TCTTTTGTTG TTGATCCAGA GCAACGACGC ATACGAGTTT TTGGTTGGAG GTTCTGGTGA TTGGAGTCTT GCATCAACCA ACTATAATCA  ATGGGCCGAA AAAAGCCGTT TCCAAATTGG TGACACCGTC TTATTCAAAT ATGAAGCCGA GAAGGACTCG GTGGTTGAAG TGAGCAAAGA TGATTACAAC AATTGCAACG CAGCATCACC  CATTGCAAAG TATAGTGATG GTCACTCAAT GGTCAAGTTG AACCAATCTG GACCTCATTA TTTCATTAGT GGACTTGTTG AGAACTGCAA AAACAACGAG AAAGTTGTGA TTGTTGTCAT  GGCTGATCGA AGCAAACACC ACCAATCGCC GCCAAGCTCA CCACCGTCTC CAGTTCCAGC AGTTGAAGAG TTGCCATCTC CACCACCCGC TCCAGCAACA GAAGATAATA ACCCGACTCC  AGCCCCTAGT GCCGCTTCTT CAGCTGTCAT GAGTTTCGTG TGTTCTGTCA TTGCTTTTGC TGGCTCTTCT GCTCTTTATG TTATTTGATT GCGCAAGTGA CTTGTTTGCC TTGTTTATTG 
TTGTAGGCTT CTGTATGATA CATAAATAAG TTGTCACGTT GATTATATTA TTTATAACAA TATTTGTATA GGTGTTCATA AAC 

Retrieve as FASTA