Entry information : HaENODL12HanXRQChr12g0357621
Entry ID 14531
Creation 2017-11-07 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaENODL12HanXRQChr12g0357621
Name HaENODL12HanXRQChr12g0357621
Class Early nodulin    [Orthogroup: ENODL009]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaENODL12
start..stop
S start..stop
HaENODL16 218 1e-73 1..180 1..181
ThasENODL08 142 7e-44 13..150 15..156
ThasENODL06 137 8e-42 4..167 1..152
AtENODL24 137 1e-41 26..139 19..138
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9985354..9985543 190 N° 2 9984868..9985247 380  
complement(join(9984868..9985247,9985354..9985543))


exon

Literature and cross-references HaENODL12HanXRQChr12g0357621
DNA ref. HanXRQ genome:   HanXRQChr12 (9985543..9984868)
Protein sequence: HaENODL12HanXRQChr12g0357621
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   189 (162)
PWM (Da):   %s   20769.43 (17606.9)  
PI (pH):   %s   6.01 (6.35) Peptide Signal:   %s   cut: 28 range:28-189
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGLMRFSLLCFVTFFVLFSLNFDAYEAREFVVGGKENSWRIPTSADTLNMWAQHERFKIGDSLVFKYDSKNDSVLRVEEGDYKKCIKAKPIEEYHDGNTTININESGAFFFISGADGHCEKGEKVEIRVLSHKHSAPPPSQAPKSSPATLTPPVTPAESPKSGSVGLDLWIMDVFVVAVATTLVGISMV

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTGATGAGGTTTTCTTTGTTGTGTTTTGTTACGTTTTTCGTTTTGTTTTCACTAAACTTTGACGCGTATGAAGCAAGAGAGTTTGTAGTCGGTGGAAAAGAGAACTCATGGCGT
ATCCCCACCTCTGCTGACACGTTAAACATGTGGGCGCAACACGAACGGTTCAAGATCGGAGATTCGCTTG
GTAAATGTTGATTTGTTTTTCTTTTATAAACATTTTATAAACATGTCCAT
ATATGACTATATGTTATAGTATACAATTTATGTTTTTTAATTTTTTTGCTATTTAGTGTTTAAATACGATTCGAAGAATGATTCGGTGTTACGAGTGGAGGAAGGAGACTACAAGAAATG
CATCAAAGCCAAGCCGATCGAAGAGTACCACGATGGTAACACGACGATCAATATTAACGAGTCAGGGGCATTCTTTTTCATTAGTGGTGCTGATGGACATTGTGAGAAGGGTGAGAAGGT
TGAGATTAGGGTTTTGTCACACAAACATAGCGCACCACCACCATCTCAAGCTCCTAAATCATCTCCGGCCACCCTAACTCCGCCGGTTACTCCAGCCGAATCTCCAAAATCTGGTTCGGT
GGGGTTGGATCTTTGGATCATGGATGTGTTCGTTGTTGCTGTGGCTACTACCTTGGTTGGAATCTCTATGGTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTGATGAGGTTTTCTTTGTTGTGTTTTGTTACGTTTTTCGTTTTGTTTTCACTAAACTTTGACGCGTATGAAGCAAGAGAGTTTGTAGTCGGTGGAAAAGAGAACTCATGGCGT
ATCCCCACCTCTGCTGACACGTTAAACATGTGGGCGCAACACGAACGGTTCAAGATCGGAGATTCGCTTG
TGTTTAAATACGATTCGAAGAATGATTCGGTGTTACGAGTGGAGGAAGGA
GACTACAAGAAATGCATCAAAGCCAAGCCGATCGAAGAGTACCACGATGGTAACACGACGATCAATATTAACGAGTCAGGGGCATTCTTTTTCATTAGTGGTGCTGATGGACATTGTGAG
AAGGGTGAGAAGGTTGAGATTAGGGTTTTGTCACACAAACATAGCGCACCACCACCATCTCAAGCTCCTAAATCATCTCCGGCCACCCTAACTCCGCCGGTTACTCCAGCCGAATCTCCA
AAATCTGGTTCGGTGGGGTTGGATCTTTGGATCATGGATGTGTTCGTTGTTGCTGTGGCTACTACCTTGGTTGGAATCTCTATGGTTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTGA TGAGGTTTTC TTTGTTGTGT TTTGTTACGT TTTTCGTTTT GTTTTCACTA AACTTTGACG CGTATGAAGC AAGAGAGTTT GTAGTCGGTG GAAAAGAGAA CTCATGGCGT  ATCCCCACCT CTGCTGACAC GTTAAACATG TGGGCGCAAC ACGAACGGTT CAAGATCGGA GATTCGCTTG TGTTTAAATA CGATTCGAAG AATGATTCGG TGTTACGAGT GGAGGAAGGA  GACTACAAGA AATGCATCAA AGCCAAGCCG ATCGAAGAGT ACCACGATGG TAACACGACG ATCAATATTA ACGAGTCAGG GGCATTCTTT TTCATTAGTG GTGCTGATGG ACATTGTGAG  AAGGGTGAGA AGGTTGAGAT TAGGGTTTTG TCACACAAAC ATAGCGCACC ACCACCATCT CAAGCTCCTA AATCATCTCC GGCCACCCTA ACTCCGCCGG TTACTCCAGC CGAATCTCCA 
AAATCTGGTT CGGTGGGGTT GGATCTTTGG ATCATGGATG TGTTCGTTGT TGCTGTGGCT ACTACCTTGG TTGGAATCTC TATGGTTTAA 

Retrieve as FASTA