Entry information : HaENODL24HanXRQChr17g0541621
Entry ID 14543
Creation 2017-11-07 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaENODL24HanXRQChr17g0541621
Name HaENODL24HanXRQChr17g0541621
Class Early nodulin    [Orthogroup: ENODL001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaENODL24
start..stop
S start..stop
ThasENODL03 153 1e-47 7..132 6..131
AtENODL18 149 8e-46 6..200 8..199
AtENODL17 144 1e-43 6..169 5..175
HaENODL15 141 3e-42 16..130 28..142
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27284429..27284603 175 N° 2 27283842..27284269 428  
complement(join(27283842..27284269,27284429..27284603))


exon

Literature and cross-references HaENODL24HanXRQChr17g0541621
DNA ref. HanXRQ genome:   HanXRQChr17 (27284603..27283842)
Protein sequence: HaENODL24HanXRQChr17g0541621
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   200 (176)
PWM (Da):   %s   21639.13 (19107.8) Transmb domain:   %s   i7-29o176-198i
PI (pH):   %s   8.49 (8.71) Peptide Signal:   %s   cut: 25 range:25-200
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEHQTKLVTMFGLVVILSIGSCSGYTFHVGGKDGWVLDPRESYNHWAERNRFQVNDSLVFKYKKGLDSVLVVNEEAYGNCNKTNPVETLNGENPIFKFKRSGPFFFISGHEQKCQNGQKLIIVVMAVRHHPRIVNSTTAPAPAPARDLAPSATLQTTEGITMHAPAPAPVISGVESIGFGGFVGLFSGLVLGLVLVLNEF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCACCAAACGAAGCTCGTTACAATGTTCGGTTTGGTGGTCATATTGTCTATTGGGTCGTGTTCTGGTTACACATTCCATGTAGGTGGCAAAGATGGTTGGGTTCTCGACCCTCGT
GAGAGCTACAACCACTGGGCTGAACGAAATCGGTTTCAAGTCAATGACTCACTTG
GTTAGTTAATAAATAACAGTTTCTTGCTCGCCCTATATATATTTATATATAGAGTTGTTGCCGTT
CAAAAAAAAAAAAAAAACAATACTAATCTCTTTCTCTCAAGAATTGAAACTTACATGTTTGTTTGTTTGTGTGTTTGATATTGTAATGCTGCAGTTTTCAAGTATAAGAAAGGGTTGGAT
TCGGTTTTGGTGGTGAACGAAGAGGCTTACGGCAACTGCAACAAAACAAACCCTGTAGAAACCCTAAATGGTGAAAACCCTATATTCAAATTCAAAAGATCAGGTCCTTTTTTCTTTATT
AGTGGTCATGAACAAAAATGCCAGAATGGACAGAAGCTGATCATCGTAGTCATGGCGGTCAGGCACCACCCGCGCATTGTGAACTCTACTACCGCTCCAGCACCAGCACCGGCACGTGAT
CTGGCGCCATCCGCCACATTACAAACTACTGAAGGAATTACTATGCATGCCCCGGCCCCGGCTCCAGTGATCTCAGGCGTTGAATCTATTGGTTTTGGAGGTTTTGTTGGATTATTTTCG
GGTTTGGTTTTGGGTCTGGTTTTGGTTTTGAATGAGTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCACCAAACGAAGCTCGTTACAATGTTCGGTTTGGTGGTCATATTGTCTATTGGGTCGTGTTCTGGTTACACATTCCATGTAGGTGGCAAAGATGGTTGGGTTCTCGACCCTCGT
GAGAGCTACAACCACTGGGCTGAACGAAATCGGTTTCAAGTCAATGACTCACTTG
TTTTCAAGTATAAGAAAGGGTTGGATTCGGTTTTGGTGGTGAACGAAGAGGCTTACGGCAACTGC
AACAAAACAAACCCTGTAGAAACCCTAAATGGTGAAAACCCTATATTCAAATTCAAAAGATCAGGTCCTTTTTTCTTTATTAGTGGTCATGAACAAAAATGCCAGAATGGACAGAAGCTG
ATCATCGTAGTCATGGCGGTCAGGCACCACCCGCGCATTGTGAACTCTACTACCGCTCCAGCACCAGCACCGGCACGTGATCTGGCGCCATCCGCCACATTACAAACTACTGAAGGAATT
ACTATGCATGCCCCGGCCCCGGCTCCAGTGATCTCAGGCGTTGAATCTATTGGTTTTGGAGGTTTTGTTGGATTATTTTCGGGTTTGGTTTTGGGTCTGGTTTTGGTTTTGAATGAGTTT
TGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCACC AAACGAAGCT CGTTACAATG TTCGGTTTGG TGGTCATATT GTCTATTGGG TCGTGTTCTG GTTACACATT CCATGTAGGT GGCAAAGATG GTTGGGTTCT CGACCCTCGT  GAGAGCTACA ACCACTGGGC TGAACGAAAT CGGTTTCAAG TCAATGACTC ACTTGTTTTC AAGTATAAGA AAGGGTTGGA TTCGGTTTTG GTGGTGAACG AAGAGGCTTA CGGCAACTGC  AACAAAACAA ACCCTGTAGA AACCCTAAAT GGTGAAAACC CTATATTCAA ATTCAAAAGA TCAGGTCCTT TTTTCTTTAT TAGTGGTCAT GAACAAAAAT GCCAGAATGG ACAGAAGCTG  ATCATCGTAG TCATGGCGGT CAGGCACCAC CCGCGCATTG TGAACTCTAC TACCGCTCCA GCACCAGCAC CGGCACGTGA TCTGGCGCCA TCCGCCACAT TACAAACTAC TGAAGGAATT  ACTATGCATG CCCCGGCCCC GGCTCCAGTG ATCTCAGGCG TTGAATCTAT TGGTTTTGGA GGTTTTGTTG GATTATTTTC GGGTTTGGTT TTGGGTCTGG TTTTGGTTTT GAATGAGTTT 
TGA 

Retrieve as FASTA