Entry information : HaCRX02 (HanXRQChr05g0144621)
Entry ID 14545
Creation 2017-11-07 (Christophe Dunand)
Last sequence changes 2017-12-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-12-08 (Christophe Dunand)
Peroxidase information: HaCRX02 (HanXRQChr05g0144621)
Name (synonym) HaCRX02 (HanXRQChr05g0144621)
Class Other cupredoxin Protein    [Orthogroup: CRX002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaCRX02
start..stop
S start..stop
HaCRX04 288 1e-102 1..138 1..138
HaCRX03 160 5e-52 1..137 1..143
HaSTC30 136 3e-43 1..78 23..100
HaCRX05 123 7e-38 45..138 18..113
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 129990643..129990811 169 N° 2 129990908..129991155 248  
join(129990643..129990811,129990908..129991155)


exon

Literature and cross-references HaCRX02 (HanXRQChr05g0144621)
DNA ref. HanXRQ genome:   HanXRQChr05 (129990643..129991155)
Protein sequence: HaCRX02 (HanXRQChr05g0144621)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   138 (114)
PWM (Da):   %s   15247.76 (12576.3)  
PI (pH):   %s   7.79 (6.75) Peptide Signal:   %s   cut: 25 range:25-138
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANKNLCIFILIATIVTQATWVRAVEYTVGECKGWNEGVDFQAWADGKQYVQGDRLVFNYEYGKHNVVLLPDQASLDNCNLEKPLISLAHCGRNVVNLRTPGRVFVSSAVGEDCKKGLKFWVDVKPCPAVLQGAHYIT

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAACAAAAATTTGTGTATATTCATCCTCATAGCAACAATAGTGACTCAAGCTACATGGGTTCGAGCTGTGGAATATACGGTTGGTGAATGTAAAGGTTGGAACGAGGGTGTTGAT
TTCCAAGCTTGGGCCGACGGGAAGCAATATGTTCAAGGAGACAGACTTG
GTATATTCTTATACATAATTAATCATACATGATTTGATTTGTTGGTGTTTTTAATAAGTCTTCTACCTAAT
TAAATTATCTATATTGCTGATGCAGTTTTCAATTACGAATACGGAAAACACAATGTAGTGTTACTACCAGATCAAGCCTCATTGGATAACTGTAATCTTGAGAAACCACTTATATCACTC
GCTCATTGTGGAAGGAATGTTGTCAACCTACGTACCCCGGGAAGGGTTTTTGTATCCAGTGCCGTCGGAGAGGATTGTAAGAAAGGCCTGAAGTTTTGGGTCGATGTCAAGCCATGTCCT
GCAGTACTGCAAGGAGCACACTACATAACTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAACAAAAATTTGTGTATATTCATCCTCATAGCAACAATAGTGACTCAAGCTACATGGGTTCGAGCTGTGGAATATACGGTTGGTGAATGTAAAGGTTGGAACGAGGGTGTTGAT
TTCCAAGCTTGGGCCGACGGGAAGCAATATGTTCAAGGAGACAGACTTG
TTTTCAATTACGAATACGGAAAACACAATGTAGTGTTACTACCAGATCAAGCCTCATTGGATAACTGTAAT
CTTGAGAAACCACTTATATCACTCGCTCATTGTGGAAGGAATGTTGTCAACCTACGTACCCCGGGAAGGGTTTTTGTATCCAGTGCCGTCGGAGAGGATTGTAAGAAAGGCCTGAAGTTT
TGGGTCGATGTCAAGCCATGTCCTGCAGTACTGCAAGGAGCACACTACATAACTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGAAGCAAT TAAAATGGCT AACAAAAATT TGTGTATATT CATCCTCATA GCAACAATAG TGACTCAAGC TACATGGGTT CGAGCTGTGG AATATACGGT TGGTGAATGT AAAGGTTGGA  ACGAGGGTGT TGATTTCCAA GCTTGGGCCG ACGGGAAGCA ATATGTTCAA GGAGACAGAC TTGTTTTCAA TTACGAATAC GGAAAACACA ATGTAGTGTT ACTACCAGAT CAAGCCTCAT  TGGATAACTG TAATCTTGAG AAACCACTTA TATCACTCGC TCATTGTGGA AGGAATGTTG TCAACCTACG TACCCCGGGA AGGGTTTTTG TATCCAGTGC CGTCGGAGAG GATTGTAAGA  AAGGCCTGAA GTTTTGGGTC GATGTCAAGC CATGTCCTGC AGTACTGCAA GGAGCACACT ACATAACTTA AAATTGAGGA TTGCGTGTCT CGGCTTTTAT ACATTTTTTT TGTGTGTGTG  TTTGTTAATA ATTGTTCATA TTTGCTTGGG TTTAATGTTA ATGGCTTTCT TGCCTCCTCT ATTCTCATTC CTCAAATATA TATAGACATG TACAAAACCC TAGAATTAAT TACAATTGAC 
ATAATTATGG AAAT 

Retrieve as FASTA