Entry information : HaCRX03HanXRQChr05g0145351
Entry ID 14546
Creation 2017-11-07 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaCRX03HanXRQChr05g0145351
Name HaCRX03HanXRQChr05g0145351
Class Other cupredoxin Protein    [Orthogroup: CRX002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaCRX03
start..stop
S start..stop
HaCRX04 160 5e-52 1..143 1..137
HaCRX02 160 5e-52 1..143 1..137
HaSTC30 96 3e-27 1..85 23..100
HaSTC22 84 3e-21 1..133 6..126
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 129923407..129923596 190 N° 2 129923069..129923313 245  
complement(join(129923069..129923313,129923407..129923596))


exon

Literature and cross-references HaCRX03HanXRQChr05g0145351
DNA ref. HanXRQ genome:   HanXRQChr05 (129923596..129923069)
Protein sequence: HaCRX03HanXRQChr05g0145351
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   144 (120)
PWM (Da):   %s   15520.78 (12879.3) Transmb domain:   %s   i5-22o
PI (pH):   %s   7.29 (5.69) Peptide Signal:   %s   cut: 25 range:25-144
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANKNLCIFILIATIVAQATWVRAAKDYQVGDFGEGYNGLGWDETTDLQAWVKGKEFNQGDRLYFGYKAGEHNVVVLADQAALDSCTLTNPKIQSPSCGYNLITLSAGPNFITSGMGEDCKNGMKLKIDAKPAPALMKGRHLIL

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAACAAAAATTTGTGCATCTTCATCCTCATAGCAACAATAGTGGCTCAAGCTACATGGGTTCGGGCTGCTAAGGACTATCAGGTTGGAGATTTCGGAGAGGGTTATAATGGATTA
GGTTGGGACGAGACTACTGATTTACAAGCTTGGGTCAAGGGGAAGGAATTCAATCAGGGAGACAGACTTT
GTACATTCTTATACATTATACATGATTTGTTTTAATTTTTTGATGATCAA
TTATGCAAGTCTTCTAACTAATTAAACTATATTGTTGATGTAGACTTTGGTTACAAAGCTGGAGAACATAATGTAGTGGTACTAGCAGATCAAGCCGCGTTAGACTCATGTACTCTTACG
AATCCGAAAATTCAATCCCCTTCTTGCGGATATAATTTAATTACCTTAAGCGCCGGACCCAATTTCATTACCAGTGGCATGGGAGAGGATTGTAAGAATGGCATGAAGTTAAAAATTGAT
GCCAAGCCAGCTCCTGCACTAATGAAAGGAAGACACCTGATACTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAACAAAAATTTGTGCATCTTCATCCTCATAGCAACAATAGTGGCTCAAGCTACATGGGTTCGGGCTGCTAAGGACTATCAGGTTGGAGATTTCGGAGAGGGTTATAATGGATTA
GGTTGGGACGAGACTACTGATTTACAAGCTTGGGTCAAGGGGAAGGAATTCAATCAGGGAGACAGACTTT
ACTTTGGTTACAAAGCTGGAGAACATAATGTAGTGGTACTAGCAGATCAA
GCCGCGTTAGACTCATGTACTCTTACGAATCCGAAAATTCAATCCCCTTCTTGCGGATATAATTTAATTACCTTAAGCGCCGGACCCAATTTCATTACCAGTGGCATGGGAGAGGATTGT
AAGAATGGCATGAAGTTAAAAATTGATGCCAAGCCAGCTCCTGCACTAATGAAAGGAAGACACCTGATACTTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CGAGAATGCA ATAAGAAGCA ATTATAATGG CTAACAAAAA TTTGTGCATC TTCATCCTCA TAGCAACAAT AGTGGCTCAA GCTACATGGG TTCGGGCTGC TAAGGACTAT CAGGTTGGAG  ATTTCGGAGA GGGTTATAAT GGATTAGGTT GGGACGAGAC TACTGATTTA CAAGCTTGGG TCAAGGGGAA GGAATTCAAT CAGGGAGACA GACTTTACTT TGGTTACAAA GCTGGAGAAC  ATAATGTAGT GGTACTAGCA GATCAAGCCG CGTTAGACTC ATGTACTCTT ACGAATCCGA AAATTCAATC CCCTTCTTGC GGATATAATT TAATTACCTT AAGCGCCGGA CCCAATTTCA  TTACCAGTGG CATGGGAGAG GATTGTAAGA ATGGCATGAA GTTAAAAATT GATGCCAAGC CAGCTCCTGC ACTAATGAAA GGAAGACACC TGATACTTTA AAATTGAGGA TTGCATGTCT  TGGCTTGTAT ATATATATAT ATATGTATAT GTATATGTCC CTTTTCTTGG GTGTTTGGTA AATGATGGTT TATATCGATT AGGCATGGAA CTTCTTGTTC TGACCATATG TAAATAAATG 
TAATTAAGTT CTATAATAAA ATGAATTTAC TATATATATG T 

Retrieve as FASTA