Entry information : HaSTC17HanXRQChr06g0177971
Entry ID 14592
Creation 2017-11-07 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaSTC17HanXRQChr06g0177971
Name HaSTC17HanXRQChr06g0177971
Class Stellacyanin    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaSTC17
start..stop
S start..stop
HaSTC33 168 8e-52 1..264 1..259
HaSTC35 168 9e-52 1..264 1..261
HaSTC32 167 3e-51 1..264 1..261
HaSTC34 167 3e-51 1..264 1..261
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45844656..45844803 148 N° 2 45845061..45845444 384 N° 3 45845537..45845805 269  
join(45844656..45844803,45845061..45845444,45845537..45845805)


exon

Literature and cross-references HaSTC17HanXRQChr06g0177971
DNA ref. HanXRQ genome:   HanXRQChr06 (45844656..45845805)
Protein sequence: HaSTC17HanXRQChr06g0177971
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 266 (248)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
29618.14 (27589.9)  
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
7.53 (6.94) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 19 range:19-266
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARKLWSIFIILIATTVAEEVKHTVHNINWSAGANAREKARDIRVGDTLIFRYKAGEHDLIEVDKDSYDKCIVPPSAKIFTTGKDALFVHTPGPKYFICGFPQHCKDRDMKLQIEVRDQSDPKLQIDDPNHRKLESTPGPTQPELIVFVVGDDKGWNENVDFEAWAKGKEFYMGDFLAFNYTVGKHNVLGVDEAAFNECTIPKDQNEALSSGKDQVRLLSMGKLGFISGIGKDCENGMKLLINVKCPHTRPKPPALQGGRKLVPSI

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGAAAATTGTGGAGCATCTTCATCATCCTCATAGCAACCACAGTTGCTGAAGAGGTAAAACACACAGTGCATAATATTAATTGGAGTGCCGGTGCCAATGCTCGTGAAAAAGCG
CGAGATATCAGAGTTGGTGACACACTTA
GTAAGAATTTAAACCTTTTATCGATTCATTAGTGATTCACGTACATTTTTTCACTATTCATCCATATGTTTAAGCAGTAATTATGCAAACCA
GAACACATTTTCATGAATAATAAGTTAATAACAACATACATAATTTGGTTTATGCGAATAACATAACGCTGATATTATTGGTATAAGTACGTAATTATAAGATTATGCTGCTAAAAAAAG
TAAAATGTCTAATGTATAGTTACATACGATACCTATGCGATGTAGTTTTCAGATATAAAGCTGGAGAACATGATTTGATTGAAGTCGATAAGGATAGCTATGACAAATGTATTGTGCCTC
CGTCTGCTAAAATTTTCACTACTGGAAAGGATGCGCTATTCGTACATACCCCAGGACCAAAATATTTCATTTGTGGATTTCCACAACACTGCAAGGACCGTGATATGAAGCTTCAAATAG
AGGTTCGCGATCAATCAGATCCGAAGCTTCAAATTGATGATCCCAACCACAGGAAACTAGAATCAACTCCAGGTCCAACACAACCGGAGTTGATTGTGTTCGTGGTTGGAGATGATAAAG
GATGGAATGAAAATGTTGATTTCGAAGCTTGGGCCAAGGGGAAGGAATTTTATATGGGAGACTTTCTTG
GTACATTTTTATACATGACACATATATTGTTGTTCTCTAATAATTATATGT
CTTGTAGCACGCTAACTAATTGCACACTATTGTTGATGTAGCGTTCAACTACACAGTAGGGAAACATAATGTATTAGGAGTAGACGAGGCGGCGTTTAACGAATGTACAATTCCTAAAGA
TCAAAATGAAGCTCTTTCTTCTGGAAAGGATCAGGTCCGCTTACTATCCATGGGAAAACTTGGGTTTATTAGCGGCATTGGAAAGGATTGTGAGAATGGCATGAAGCTTCTCATCAATGT
CAAGTGCCCACACACCAGACCCAAGCCTCCTGCATTGCAAGGAGGAAGAAAACTAGTTCCATCAATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGAAAATTGTGGAGCATCTTCATCATCCTCATAGCAACCACAGTTGCTGAAGAGGTAAAACACACAGTGCATAATATTAATTGGAGTGCCGGTGCCAATGCTCGTGAAAAAGCG
CGAGATATCAGAGTTGGTGACACACTTA
TTTTCAGATATAAAGCTGGAGAACATGATTTGATTGAAGTCGATAAGGATAGCTATGACAAATGTATTGTGCCTCCGTCTGCTAAAATTTTC
ACTACTGGAAAGGATGCGCTATTCGTACATACCCCAGGACCAAAATATTTCATTTGTGGATTTCCACAACACTGCAAGGACCGTGATATGAAGCTTCAAATAGAGGTTCGCGATCAATCA
GATCCGAAGCTTCAAATTGATGATCCCAACCACAGGAAACTAGAATCAACTCCAGGTCCAACACAACCGGAGTTGATTGTGTTCGTGGTTGGAGATGATAAAGGATGGAATGAAAATGTT
GATTTCGAAGCTTGGGCCAAGGGGAAGGAATTTTATATGGGAGACTTTCTTG
CGTTCAACTACACAGTAGGGAAACATAATGTATTAGGAGTAGACGAGGCGGCGTTTAACGAATGTACA
ATTCCTAAAGATCAAAATGAAGCTCTTTCTTCTGGAAAGGATCAGGTCCGCTTACTATCCATGGGAAAACTTGGGTTTATTAGCGGCATTGGAAAGGATTGTGAGAATGGCATGAAGCTT
CTCATCAATGTCAAGTGCCCACACACCAGACCCAAGCCTCCTGCATTGCAAGGAGGAAGAAAACTAGTTCCATCAATTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAGCTTGTGC CTTAAAATAG GCATATAAAT TGTTAGTCCA TGACCATCCA TGCCTTCAAA TAGGCATAAA TTCATAAAAA CATAGTTGGT TGAAAGTGAA CGAAAATGGC TAGAAAATTG  TGGAGCATCT TCATCATCCT CATAGCAACC ACAGTTGCTG AAGAGGTAAA ACACACAGTG CATAATATTA ATTGGAGTGC CGGTGCCAAT GCTCGTGAAA AAGCGCGAGA TATCAGAGTT  GGTGACACAC TTATTTTCAG ATATAAAGCT GGAGAACATG ATTTGATTGA AGTCGATAAG GATAGCTATG ACAAATGTAT TGTGCCTCCG TCTGCTAAAA TTTTCACTAC TGGAAAGGAT  GCGCTATTCG TACATACCCC AGGACCAAAA TATTTCATTT GTGGATTTCC ACAACACTGC AAGGACCGTG ATATGAAGCT TCAAATAGAG GTTCGCGATC AATCAGATCC GAAGCTTCAA  ATTGATGATC CCAACCACAG GAAACTAGAA TCAACTCCAG GTCCAACACA ACCGGAGTTG ATTGTGTTCG TGGTTGGAGA TGATAAAGGA TGGAATGAAA ATGTTGATTT CGAAGCTTGG  GCCAAGGGGA AGGAATTTTA TATGGGAGAC TTTCTTGCGT TCAACTACAC AGTAGGGAAA CATAATGTAT TAGGAGTAGA CGAGGCGGCG TTTAACGAAT GTACAATTCC TAAAGATCAA  AATGAAGCTC TTTCTTCTGG AAAGGATCAG GTCCGCTTAC TATCCATGGG AAAACTTGGG TTTATTAGCG GCATTGGAAA GGATTGTGAG AATGGCATGA AGCTTCTCAT CAATGTCAAG  TGCCCACACA CCAGACCCAA GCCTCCTGCA TTGCAAGGAG GAAGAAAACT AGTTCCATCA ATTTAAAAAT GCTGAGCTTT AAGGATTTTT TTGGATTGTG TGGGACATTA CATTTATTGT  AATGCTCTTG TGATACGTAA GCCTTCTGGT GTGTGTTACT ACTTGTTTAT AGTGGCTAGA GTAGAGAGCC TGTTTGGTGT TGTAATATTA GATATGTAAC ATCTTGTCTA ATTGAGAATT 
ATGTGCAAGT AAATTGGATA ATGAAATCTG TTGGATTTAT 

Retrieve as FASTA