Entry information : HaSTC30HanXRQChr17g0547691
Entry ID 14605
Creation 2017-11-07 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaSTC30HanXRQChr17g0547691
Name HaSTC30HanXRQChr17g0547691
Class Stellacyanin    [Orthogroup: STC003]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaSTC30
start..stop
S start..stop
HaCRX04 136 2e-43 23..100 1..78
HaCRX02 136 2e-43 23..100 1..78
HaCRX03 96 3e-27 23..100 1..85
HaSTC22 89 4e-24 22..89 5..72
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 52475640..52475874 235 N° 2 52475483..52475550 68  
complement(join(52475483..52475550,52475640..52475874))


exon

Literature and cross-references HaSTC30HanXRQChr17g0547691
DNA ref. HanXRQ genome:   HanXRQChr17 (52475874..52475483)
Protein sequence: HaSTC30HanXRQChr17g0547691
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   100
PWM (Da):   %s   11418.67  
PI (pH):   %s   8.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLPFFINWKSKMYPRMQQEEIKMANKNLCLFILIATIVTQATWVRAVEYNAGDCKAWNEGVDLQAWADGKQFYKGDSIVFNYECGKHNVALLQDKASLDN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCCTTTCTTTATAAATTGGAAGTCCAAGATGTATCCTAGAATGCAACAAGAAGAAATTAAAATGGCTAACAAAAATTTGTGTCTTTTCATCCTCATAGCAACAATAGTGACTCAA
GCTACATGGGTTCGAGCTGTGGAATATAATGCTGGTGACTGTAAAGCTTGGAACGAGGGTGTTGATCTCCAAGCTTGGGCCGACGGGAAGCAATTCTATAAGGGAGACAGTATTG
GTACA
TTCTTATACATAATTAATCATACATGATTTGATTTGTTATAAGTGTTCGTCTAACTAATTAAATTATCTATATTGCTGATGCAGTTTTCAATTACGAATGCGGAAAACACAATGTAGCGC
TACTACAAGATAAAGCCTCGTTGGATAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCCTTTCTTTATAAATTGGAAGTCCAAGATGTATCCTAGAATGCAACAAGAAGAAATTAAAATGGCTAACAAAAATTTGTGTCTTTTCATCCTCATAGCAACAATAGTGACTCAA
GCTACATGGGTTCGAGCTGTGGAATATAATGCTGGTGACTGTAAAGCTTGGAACGAGGGTGTTGATCTCCAAGCTTGGGCCGACGGGAAGCAATTCTATAAGGGAGACAGTATTG
TTTTC
AATTACGAATGCGGAAAACACAATGTAGCGCTACTACAAGATAAAGCCTCGTTGGATAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCCTT TCTTTATAAA TTGGAAGTCC AAGATGTATC CTAGAATGCA ACAAGAAGAA ATTAAAATGG CTAACAAAAA TTTGTGTCTT TTCATCCTCA TAGCAACAAT AGTGACTCAA  GCTACATGGG TTCGAGCTGT GGAATATAAT GCTGGTGACT GTAAAGCTTG GAACGAGGGT GTTGATCTCC AAGCTTGGGC CGACGGGAAG CAATTCTATA AGGGAGACAG TATTGTTTTC  AATTACGAAT GCGGAAAACA CAATGTAGCG CTACTACAAG ATAAAGCCTC GTTGGATAAC TGAATTCTTG ATAAGCCAAT TCTAACACTC GCTGATTGTG GAAGGAATTG TCTCTTCCTA  TGTAACACAG GACCGTGTTT TGTAGCCAGC ACCAAAGGAA AGGATTGTAA GAAAGGCCTA AAGTTTTCGT TCGAAACAAA GCCATTACCT GTACTGGAAC TGGATGGAGC ACACTACTTA  ACTTAAAATT GAGGATGGCA TGTCTTGGCT TTTATACATG TTTTTTTTGT GTGTTTGTTG ATAATTGTTC ATATCGATCA GGTATGAACA ATTCTTGTTC GGATCTATAA TTATATCATA 
TGTAAGTTAC AAGGGGATTG GACAATAATA ATATCATTAT GAATTTTGGA TT 

Retrieve as FASTA