Entry information : HaPrx03 (HanXRQChr11g0325831)
Entry ID 1471
Creation 2005-08-11 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx03 (HanXRQChr11g0325831)
Name (synonym) HaPrx03 (HanXRQChr11g0325831)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx03
start..stop
S start..stop
HaPrx14 462 3e-164 80..390 19..326
LePrx80 417 1e-146 86..389 26..325
RcPrx24 390 1e-135 56..388 24..348
LuPrx120 385 1e-133 102..385 66..351
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24479140..24479541 402 N° 2 24479854..24480048 195 N° 3 24480169..24480334 166 N° 4 24480797..24481206 410
join(24479140..24479541,24479854..24480048,24480169..24480334,24480797..24481206 )


exon

Literature and cross-references HaPrx03 (HanXRQChr11g0325831)
Literature Kozik,A., Michelmore,R.W., Knapp,S., Matvienko,M., Rieseberg,L., Lin,H., van Damme,M., Lavelle,D., Chevalier,P., Ziegle,J., Ellison ,P., Kolkman,J., Slabaugh,M.S., Livingston,K., Zhou,Y., Lai,Z., Church,S., Jackson,L. and Bradford,K. Lettuce and Sunflower ESTs from the Compositae Genome Project Unpublished (2002). Genoplante
DNA ref. HanXRQ genome:   HanXRQChr11 (24479140..24481206)
EST ref. GenBank:   BQ966683 [3' end]
Cluster/Prediction ref. HanXRQ:   309   HanXRQChr11g0325831
Protein sequence: HaPrx03 (HanXRQChr11g0325831)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   390
PWM (Da):   %s   42533.49 Transmb domain:   %s   i30-47o
PI (pH):   %s   9.48
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYAYIRCWKGRFKHTKHQVKEPTKGNMMKTILVFLVASILVIGCMGGKGHGHHHGHGHGHGHGHGHGHGQGRGHGRGHGHGLGGGLQVHYYQNRCGSMGWVEKTVKDIVWNKVAADPTLAPKLLRLHYHDCFVRGCDASILLDPTQNNTEAEKTARPNRSLSGYEVIDEIKTKLEAACPETVSCADILALATRDAVSFQFKREMWPVFTGRKDGRDSLASEVSENLPSANANFTTLLTQFGNKKLNLNDLVTLSGAHTIGHSRCALVSRRLYNFTGIGDADPSLDPAYAQTLRKLCPTPVNPSTSLEMDPKSSLTFDSDYYRALNKHKGLFVSDAALLTNRQSALVAQVLENPAIFFAQFARSMVKMGAVEVLTGGQGEVRKNCRVVNGK

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATGCCTATATAAGGTGTTGGAAGGGAAGGTTCAAACATACAAAACATCAAGTGAAAGAACCCACAAAGGGAAATATGATGAAAACCATTCTTGTATTTTTGGTTGCTTCCATTTTG
GTGATTGGGTGCATGGGTGGTAAAGGTCACGGTCACCATCATGGTCATGGTCATGGTCATGGTCATGGTCATGGTCATGGTCATGGTCAGGGCCGCGGTCATGGTCGGGGCCATGGTCAT
GGTCTTGGTGGGGGTTTGCAGGTGCATTATTACCAGAACCGATGTGGTTCGATGGGTTGGGTTGAAAAGACTGTAAAGGATATCGTATGGAACAAAGTTGCTGCAGATCCTACCCTGGCT
CCCAAGCTTCTAAGGCTTCATTACCATGATTGTTTTGTCAGA
GTAAGTAATCAAATCATCTTAATGGGAATTTTATGTATTTGATTAATTAAACGTCAACGCGTTAGTGGTTAGCCTTAA
GTCATTTTGGCAAAGATCTTAGGTTCGAAATGGCTAGTTCTTATTGTCGGCGCAAGCTGATATTTACTTCATCTAATTGGTTAGCAAGGTCCTGTAGAGGCCTAGGGTCAGTGAGTTTTC
TGGTAACCAATTACTAAAAGAAAAATATATTTGATAATAAATCACTTTGAGCCCATTGTAGATTATTTGGAGCCAAAGTTCCACATTAGCAATAACTAACTTTTGAGCTTGTAGGGATGT
GATGCATCAATTCTATTGGATCCTACTCAAAACAACACAGAGGCAGAAAAGACGGCTAGACCAAACAGATCTCTTTCTGGGTACGAGGTAATTGATGAAATAAAGACAAAGTTGGAAGCC
GCTTGTCCGGAAACTGTTTCATGTGCTGACATTCTTGCCTTGGCAACTAGAGATGCTGTTTCCTTCCAG
GTAAGTGATTTACACCAATGACCGAAATTTTCATGATCTTGAGTTTTATAA
CAAAGTAGCTACCGCTACGTACCTTATTTGTCGAACTCATGGTTTCATCGTCGTCATCGAAAATCGCAGTTTAAGAGAGAAATGTGGCCGGTTTTTACGGGAAGGAAAGACGGAAGAGAT
TCGTTGGCATCGGAAGTCAGTGAGAATTTACCGTCTGCGAACGCCAACTTCACAACCCTCCTAACCCAATTTGGAAACAAAAAGCTTAACCTCAACGATCTTGTCACACTTTCGG
GTATA
CATACTACTATGTATACATGTATGCATGTATATATGCAATATTTTGGATTAGTAGGTGTGTTTTGGAAGTCTGTTCGCTATCCTATAAGCAAAATCATGCAAGTTCTGACAATGTCTTAG
GAGTTCGATGGTATGGCAAGCGAAGTGGGAAAGTTTACACGGGTGACAAGCGAACACCATAGAGTTTTTCACCAAACTTAACCTCACCGTTGCGTATAGTTTTTTACCAAATTCATGGAG
TTCGCTTGTGTCCAAGCGAACTTGTCGAATTCGCTTGAAGAGGTAGCGAATTTCCTAGAAAAAAATGCGTAGACATACTTAGTTGAATTAATCCTAATCCAACTACTAATCCAAAAATAT
TTGTATATATGCACGTATGCATGCATGCATCTATATATATACTTCTTTTCTACACCATTTTGTGTTATGTAACTAACCTTTTTTTGTGATTAACTAGGGGCACACACAATTGGGCACTCA
CGTTGTGCCTTAGTCTCCAGAAGACTTTACAACTTCACAGGAATAGGGGACGCTGACCCGTCTCTTGATCCGGCTTATGCACAAACATTGAGGAAACTATGCCCAACCCCAGTGAACCCA
TCCACCAGTCTTGAAATGGATCCTAAAAGCTCTCTCACTTTCGACTCCGATTACTATCGCGCCTTAAATAAACATAAGGGTCTATTTGTATCCGATGCAGCATTACTCACGAACCGACAA
TCGGCTTTGGTGGCACAGGTTTTAGAAAACCCTGCGATATTCTTTGCTCAATTTGCTAGGTCCATGGTGAAAATGGGGGCTGTTGAAGTTCTTACAGGTGGTCAAGGAGAAGTTAGGAAA
AATTGTAGAGTTGTTAATGGTAAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATGCCTATATAAGGTGTTGGAAGGGAAGGTTCAAACATACAAAACATCAAGTGAAAGAACCCACAAAGGGAAATATGATGAAAACCATTCTTGTATTTTTGGTTGCTTCCATTTTG
GTGATTGGGTGCATGGGTGGTAAAGGTCACGGTCACCATCATGGTCATGGTCATGGTCATGGTCATGGTCATGGTCATGGTCATGGTCAGGGCCGCGGTCATGGTCGGGGCCATGGTCAT
GGTCTTGGTGGGGGTTTGCAGGTGCATTATTACCAGAACCGATGTGGTTCGATGGGTTGGGTTGAAAAGACTGTAAAGGATATCGTATGGAACAAAGTTGCTGCAGATCCTACCCTGGCT
CCCAAGCTTCTAAGGCTTCATTACCATGATTGTTTTGTCAGA
GGATGTGATGCATCAATTCTATTGGATCCTACTCAAAACAACACAGAGGCAGAAAAGACGGCTAGACCAAACAGATCT
CTTTCTGGGTACGAGGTAATTGATGAAATAAAGACAAAGTTGGAAGCCGCTTGTCCGGAAACTGTTTCATGTGCTGACATTCTTGCCTTGGCAACTAGAGATGCTGTTTCCTTCCAG
TTT
AAGAGAGAAATGTGGCCGGTTTTTACGGGAAGGAAAGACGGAAGAGATTCGTTGGCATCGGAAGTCAGTGAGAATTTACCGTCTGCGAACGCCAACTTCACAACCCTCCTAACCCAATTT
GGAAACAAAAAGCTTAACCTCAACGATCTTGTCACACTTTCGG
GGGCACACACAATTGGGCACTCACGTTGTGCCTTAGTCTCCAGAAGACTTTACAACTTCACAGGAATAGGGGACGCT
GACCCGTCTCTTGATCCGGCTTATGCACAAACATTGAGGAAACTATGCCCAACCCCAGTGAACCCATCCACCAGTCTTGAAATGGATCCTAAAAGCTCTCTCACTTTCGACTCCGATTAC
TATCGCGCCTTAAATAAACATAAGGGTCTATTTGTATCCGATGCAGCATTACTCACGAACCGACAATCGGCTTTGGTGGCACAGGTTTTAGAAAACCCTGCGATATTCTTTGCTCAATTT
GCTAGGTCCATGGTGAAAATGGGGGCTGTTGAAGTTCTTACAGGTGGTCAAGGAGAAGTTAGGAAAAATTGTAGAGTTGTTAATGGTAAATGA

Retrieve as FASTA