Entry information : HaPrx06 (HanXRQChr05g0129531)
Entry ID 1476
Creation 2006-09-15 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx06 (HanXRQChr05g0129531)
Name (synonym) HaPrx06 (HanXRQChr05g0129531)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx06
start..stop
S start..stop
HarPrx01 666 0 1..328 1..328
HpPrx01-1 652 0 1..328 1..331
HaPrx07 652 0 1..328 1..331
SrPrx01 647 0 1..328 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2360641..2360862 222 N° 2 2360358..2360546 189 N° 3 2359436..2359601 166 N° 4 2358945..2359354 410
complement(join(2358945..2359354,2359436..2359601,2360358..2360546,2360641..2360 862))


exon

Literature and cross-references HaPrx06 (HanXRQChr05g0129531)
Literature REFERENCE 1 Kozik,A., Michelmore,R.W., Knapp,S., Matvienko,M., Rieseberg,L., Lin,H., van Damme,M., Lavelle,D., Chevalier,P., Ziegle,J., Ellison ,P., Kolkman,J., Slabaugh,M.S., Livingston,K., Zhou,Y., Lai,Z., Church,S., Jackson,L. and Bradford,K. Lettuce and Sunflower ESTs from the Compositae Genome Project Unpublished (2002). Genoplante.
REFERENCE 2 Fernandez,P., et al., Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries Unpublished (2002)
DNA ref. HanXRQ genome:   HanXRQChr05 (2360862..2358945)
EST ref. GenBank:   DY918683.1 [5' end]   BQ971433.1 [3' end]
Cluster/Prediction ref. HanXRQ:   HanXRQChr05g0129531 UniGene:   Han.2369
Protein sequence: HaPrx06 (HanXRQChr05g0129531)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (307)
PWM (Da):   %s   36882.15 (34575.8)  
PI (pH):   %s   8.7 (8.55) Peptide Signal:   %s   cut: 22 range:22-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPKALIFLALFSLLAIVSVADTDSDSGLVLNFYKDSCPQAEDIIREQVGLLYKRHKNTAFSWLRNIFHDCAVESCDASLLLDSTRRVLSEKETDRSFGLRNFRYLETIKEALERECPGVVSCADILVLSGRDGIVALGGPYIPLKTGRRDGRRSRADILEQYLPDHNESMTVVLERFKSIGIDTPGVVALLGSHSVGRTHCVKLVHRLYPAVDPALDPGHVEHMLHKCPDAIPDPKAVQYVRNDRGTPMKLDNNYYRNILDNKGLLIVDHQLANDKRTKPYVKKMAKSQDYFFKHFGRAITILTENNPLTGTKGEIRKQCNVANKHH*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 23 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCGAAAGCTCTCATCTTCTTGGCTTTGTTCTCCCTGTTAGCCATTGTTTCAGTTGCAGACACTGACTCAGACTCAGGTCTTGTCCTCAACTTCTACAAAGATTCATGCCCACAA
GCTGAAGATATCATCAGAGAACAAGTTGGTCTTCTTTACAAACGCCACAAGAACACTGCTTTCTCTTGGCTCAGAAACATCTTCCATGACTGTGCTGTTGAG
GTATCCATGCATGCATCT
AATTCATAAATAATATCTATGAATGATTCATCCAAAAGGGTCTCAATATTTAACTGTTTTGATATATATAATATAGTCATGTGATGCTTCACTGCTTCTGGACTCAACAAGGAGGGTGCT
GTCTGAGAAAGAAACAGACAGGAGCTTTGGGCTCAGAAACTTTAGGTATCTTGAAACCATCAAGGAAGCTCTTGAGAGGGAGTGCCCTGGTGTTGTTTCTTGTGCAGATATTCTTGTGCT
TTCCGGAAGGGATGGCATTGTTGCG
GTAAATTTTCTTCATTCTTAGATATTTTCCGTACTATGTAAAAATCTGGATTTATCTTTAGTCAGTACTTGTTTTAGTTATCATAGAAATGGAAG
GCAAACGGGCAACAAGCTGCACCGCTAGCCCTTTTTGAATGGCAAAACTAAGTTTTCTAAAAACAACATTTATAGATCTTAGGGTCATAACATAACTAACTATTCATAGATCGGTATGCA
TTATCTTTAACGAACACGTGAAGCGTCATATGCTATGCGTTAGTTAGTTGTACTCATGGAGACCTAAGTTCAATTCCCATTAGTGCCACTTTGGTGGCCACCGACACCCGCTTTAAAGCC
GGACCGAGGACACTCGAGGTCTCGGGTTCGAAACATGTTTCTTACCCCTCTTTGATGGCTATGGGTATTTGCCGTCAGGGATCCTTGTCGGGTGGTGAACTGGGAAGGGAGATCCCTTCC
GCGGTCAGGGGTACCGTGCAACTACCCTTTTTTTAGTTAGTTGTACTCATGGTACTCCCTTGCATTAATGTATGCACTTTGTTTTGGATGTGTCCACTTCATGTTGTACTAGGTACAGAT
TTATGCTACTTTTCTTAATATTGATGTACACCATCAGAGTATTAGATTTGACAATCCTGCCCTCACAGTTACCACCAGTTTAACTTTGTTTTAGTGAAATTTAGAATGACTATGAAGATA
TTATTTATTTATGACAAATGTTGATTTGTGGGTGTAATTTGTTGATTATGATTTGTGGCAGCTTGGTGGGCCATACATACCTCTAAAAACAGGGAGAAGGGATGGTAGGAGGAGCAGAGC
TGATATCTTGGAGCAATATCTTCCAGATCATAATGAGAGCATGACTGTGGTTCTTGAAAGGTTCAAGAGCATTGGCATTGACACCCCTGGAGTTGTTGCTTTACTAG
GTATGTATGTGTA
TCATTATCATTATCATTATCAACCTCATGCATCATGCATGTAGTTTAACAGTGGTCTTCTTGAAATAGGTTCTCACAGTGTGGGTAGGACGCACTGCGTGAAGCTGGTGCACCGCTTATA
TCCAGCGGTGGACCCTGCTCTTGACCCGGGCCATGTTGAGCACATGCTCCACAAGTGTCCGGATGCAATCCCTGACCCAAAGGCCGTGCAGTACGTGAGAAATGACCGCGGTACACCGAT
GAAACTAGACAACAATTATTACAGGAACATTTTGGACAACAAGGGATTGTTGATTGTGGACCACCAATTGGCGAACGACAAGAGAACCAAACCATATGTGAAGAAAATGGCGAAAAGCCA
AGATTATTTCTTTAAACATTTTGGAAGAGCCATCACCATTCTTACAGAGAACAATCCACTCACTGGCACTAAAGGTGAGATTAGAAAGCAATGCAATGTTGCAAACAAGCACCATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCGAAAGCTCTCATCTTCTTGGCTTTGTTCTCCCTGTTAGCCATTGTTTCAGTTGCAGACACTGACTCAGACTCAGGTCTTGTCCTCAACTTCTACAAAGATTCATGCCCACAA
GCTGAAGATATCATCAGAGAACAAGTTGGTCTTCTTTACAAACGCCACAAGAACACTGCTTTCTCTTGGCTCAGAAACATCTTCCATGACTGTGCTGTTGAG
TCATGTGATGCTTCACTG
CTTCTGGACTCAACAAGGAGGGTGCTGTCTGAGAAAGAAACAGACAGGAGCTTTGGGCTCAGAAACTTTAGGTATCTTGAAACCATCAAGGAAGCTCTTGAGAGGGAGTGCCCTGGTGTT
GTTTCTTGTGCAGATATTCTTGTGCTTTCCGGAAGGGATGGCATTGTTGCG
CTTGGTGGGCCATACATACCTCTAAAAACAGGGAGAAGGGATGGTAGGAGGAGCAGAGCTGATATCTTG
GAGCAATATCTTCCAGATCATAATGAGAGCATGACTGTGGTTCTTGAAAGGTTCAAGAGCATTGGCATTGACACCCCTGGAGTTGTTGCTTTACTAG
GTTCTCACAGTGTGGGTAGGACG
CACTGCGTGAAGCTGGTGCACCGCTTATATCCAGCGGTGGACCCTGCTCTTGACCCGGGCCATGTTGAGCACATGCTCCACAAGTGTCCGGATGCAATCCCTGACCCAAAGGCCGTGCAG
TACGTGAGAAATGACCGCGGTACACCGATGAAACTAGACAACAATTATTACAGGAACATTTTGGACAACAAGGGATTGTTGATTGTGGACCACCAATTGGCGAACGACAAGAGAACCAAA
CCATATGTGAAGAAAATGGCGAAAAGCCAAGATTATTTCTTTAAACATTTTGGAAGAGCCATCACCATTCTTACAGAGAACAATCCACTCACTGGCACTAAAGGTGAGATTAGAAAGCAA
TGCAATGTTGCAAACAAGCACCATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCGGGGATCA CCAGTCACAG AGAGCAAAAT GGCTCCGAAA GCTCTCATCT TCTTGGCTTT GTTCTCCCTG TTAGCCATTG TTTCAGTTGC AGACACTGAC TCAGACTCAG GTCTTGTCCT  CAACTTCTAC AAAGATTCAT GCCCACAAGC TGAAGATATC ATCAGAGAAC AAGTTGGTCT TCTTTACAAA CGCCACAAGA ACACTGCTTT CTCTTGGCTC AGAAACATCT TCCATGACTG  TGCTGTTGAG TCATGTGATG CTTCACTGCT TCTGGACTCA ACAAGGAGGG TGCTGTCTGA GAAAGAAACA GACAGGAGCT TTGGGCTCAG AAACTTTAGG TATCTTGAAA CCATCAAGGA  AGCTCTTGAG AGGGAGTGCC CTGGTGTTGT TTCTTGTGCA GATATTCTTG TGCTTTCCGG AAGGGATGGC ATTGTTGCGC TTGGTGGGCC ATACATACCT CTAAAAACAG GGAGAAGGGA  TGGTAGGAGG AGCAGAGCTG ATATCTTGGA GCAATATCTT CCAGATCATA ATGAGAGCAT GACTGTGGTT CTTGAAAGGT TCAAGAGCAT TGGCATTGAC ACCCCTGGAG TTGTTGCTTT  ACTAGGTTCT CACAGTGTGG GTAGGACGCA CTGCGTGAAG CTGGTGCACC GCTTATATCC AGCGGTGGAC CCTGCTCTTG ACCCGGGCCA TGTTGAGCAC ATGCTCCACA AGTGTCCGGA  TGCAATCCCT GACCCAAAGG CCGTGCAGTA CGTGAGAAAT GACCGCGGTA CACCGATGAA ACTAGACAAC AATTATTACA GGAACATTTT GGACAACAAG GGATTGTTGA TTGTGGACCA  CCAATTGGCG AACGACAAGA GAACCAAACC ATATGTGAAG AAAATGGCGA AAAGCCAAGA TTATTTCTTT AAACATTTTG GAAGAGCCAT CACCATTCTT ACAGAGAACA ATCCACTCAC  TGGCACTAAA GGTGAGATTA GAAAGCAATG CAATGTTGCA AACAAGCACC ATTAATTAAT TAACCCAAGT TATCTTTTGT GTTTTAATTA ATGTGGAGAA TAAAAGAAGA TGGTGTGAGC 
ATCTAGCAAT CTAGGACATG TATTTCCTTT TAACTTTnTA TGTGTTTTGA GAAAAGTGAA TGCTTCCCAA TGAATGTGAA TATGGATGGA TGGAGTCTGA GTGTGTATGA TGCATG 

Retrieve as FASTA