Entry information : HaPrx11 (HanXRQChr13g0389001)
Entry ID 1481
Creation 2005-08-11 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx11 (HanXRQChr13g0389001)
Name (synonym) HaPrx11 (HanXRQChr13g0389001)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx11
start..stop
S start..stop
CiPrx02 585 0 1..321 1..321
HaPrx10 575 0 1..321 1..321
LsePrx23 544 0 1..321 1..321
LsaPrx23 499 0 1..296 1..296
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12938944..12939168 225 N° 2 12937814..12938005 192 N° 3 12936976..12937141 166 N° 4 12936500..12936882 383
complement(join(12936500..12936882,12936976..12937141,12937814..12938005,1293894 4..12939168))


exon

Literature and cross-references HaPrx11 (HanXRQChr13g0389001)
Literature Kozik,A., Michelmore,R.W., Knapp,S., Matvienko,M., Rieseberg,L., Lin,H., van Damme,M., Lavelle,D., Chevalier,P., Ziegle,J., Ellison ,P., Kolkman,J., Slabaugh,M.S., Livingston,K., Zhou,Y., Lai,Z., Church,S., Jackson,L. and Bradford,K. Lettuce and Sunflower ESTs from the Compositae Genome Project Unpublished (2002).
DNA ref. HanXRQ genome:   HanXRQChr13 (12939168..12936500)
EST ref. GenBank:   BQ965760.1 [3' end]
Cluster/Prediction ref. HanXRQ:   HanXRQChr13g0389001
Protein sequence: HaPrx11 (HanXRQChr13g0389001)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322
PWM (Da):   %s   34270.81  
PI (pH):   %s   8.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSTFSSLFKLSTFTLCLLVLFAPSSGQLTANFYARTCPNFRSIITRAVNTAVANEARMGASLLRLHFHDCFVNGCDASVLLDDTANFTGEKTAGPNSNSIRGFNVIDTIKTQLERQCPGVVSCADILAAAARDSVVALRGPGWNVLFGRRDSTTASLSAANSNLPSPTSSLSTLISSFSNQGFTANEMIALSGAHTIGQARCTTFRNRLYNENNINASFAAALRPNCPSSGGDNNLSPLDSTATSFDNRYFNDLINQRGLLHSDQELFNGGSADAQVRTYSSNPATFNREFASAMVKMSNLGPLTGSSGQVRTNCRRTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 2 ESTs. Cultivar="RHA801".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCATCAACCTTTTCTTCTTTGTTTAAGCTCTCAACTTTTACATTATGTTTATTGGTTTTGTTTGCACCTAGTTCTGGTCAGCTAACTGCCAATTTCTATGCTAGAACGTGCCCA
AATTTCCGTTCTATTATAACTAGAGCTGTCAATACGGCTGTGGCAAATGAAGCTCGCATGGGAGCCTCGTTGCTTCGCCTTCATTTCCATGATTGCTTTGTTAAT
GCAAGTCTCTAACCT
TTTAACACCACTCTTCCCTCTCCGCTTGCATATTTATGATTTTTACTTACAGTCAAGTCACTATATTTAACTTGTGTCATGTTATATAATTCTGGTATTCTCACAATGTCAATGCAACAA
TTATTGCAGTCATCTGCACATTTTTTAGACATGCAAATGCATATTCTAAACTTGTTCACACTCATAAACGTGAACGTTATGGTTAAATATATGCATATATGAGGTTCAATGTGTATAAAA
AATCAAAACAATTTTTTCACTTGTATTAGTAGAAAAATCGATTTTACACTTATAAGCTATATAACGAACATGTTCCTTAAAAAGTGCACAGATAATTTTTTTTTTCCAATCAACTTTTTA
CATGTTTTCTTGCTTGTGTAATAATCAATATTATTTTTTTATGTTTTGTCAATCAAAACAATGGGTACATTTTTATAGTAAATCTTTATAAATTTTTATAGTTATGTACACTTATAATTC
TAACCATCTTACACATATTTATAAATAAAACAATTTAATAAAGTTATATATTTCGAATAGTGCGTAGAAAAGTTTGTTTGGTCATTACAAGAATCTTCTTCATAGATACTTTTGGACGAC
AAACTAATATTTAAAATGGTTTGAACATTTGTTTGCAAGTCAAAGATCCTAATTATTTTTGATATGACACTTATATCTAAATAATATTTTGCATGCCAAGTTGCGAACTATTGGCAGAAA
ACATATCCTATTGTGTTTGGTTTCGTGCTAGTTAATTAGAGAATTTTTATTTTGATTTGTATTTGACTTTGAATACATTATTGTCTTCTCTCACGGTGTTTACTTGTTCACTTTGATGTA
TGCTACAATGATTGAATTTCGTATCACCGTCTTCTTCACTGACTTATAAAAAAAAACTTTATTTTATTTGCATGAACGTGTAGGGATGTGATGCATCCGTGTTATTGGACGATACCGCGA
ATTTCACCGGAGAAAAAACAGCAGGCCCGAATAGCAACTCGATTAGAGGTTTCAACGTCATCGATACAATCAAAACCCAATTGGAGCGCCAGTGTCCTGGTGTTGTTTCTTGTGCGGATA
TATTAGCTGCGGCTGCTAGAGATTCCGTTGTGGCT
GTAAGTGACGCATACTTACTTTTCTTGATATTACATTAGGGCCCTACAAACAAAAGGGCCCTAATGTAAGTGAAGCATACTTAGG
GTAGGGGGTATAATGCTCGGTGAGTGGTGAGGGGAGTGGGAGTCACTGATCGGTGACTATACCCACTTGATGAACTTGATCCGGTGAGTTGGAGAGAGGTGAGCAAAATCGGTGTAAAGT
CACTGAATGATGGAGGAGAGACAGAGAGGAGAGAGGAACCAATCAAAAAATATATAACTCAAACACCCTAGGGTGATTAACCATACCCCCTGATTGAGTGCAAAATGGGGAGTGGAATGA
GGAGTTGACATGGCATAATATTATTGGGTAGGATTTCACTCAATCACCCTAGAGTGATTAACCATACCCTCCACCCTTACTAATCCTACGACACCCTTAAACTCAAATATGCCACCCACA
AACTAAAAGGGCCGTTTGATCAAAAAGTTAAACAATCATTTAAAGGCATGAGGTTATGACTCAATCCCTAACCTTCAAACAGCCGTTCGGTGTAACTTAAATGGCTGTTTGAAAACGATG
TGGGGTTATATTGTCAATGGTGTGCGTATAGTAGGCTCAACATGTGACTTTAAATCAAGAAAAAAATAAATAGATAATAAATTATTTTACTTTCATTTTTTTTCCAGCTTCGTGGGCCTG
GGTGGAACGTTTTGTTCGGAAGAAGGGACTCAACAACAGCAAGTTTAAGTGCTGCAAATTCTAATCTTCCTTCACCAACTTCTAGTCTTAGTACCCTCATTTCATCTTTTTCAAACCAAG
GGTTTACTGCTAATGAAATGATAGCTCTATCAG
GTGAGTTACCTTAATATAACATTTTGGCTAACTAAGTACTGATGATTTATCAAAACCTTTTTTTAAGTAATAACGAATTCAATATTA
ATGTAGGAGCTCATACAATTGGTCAAGCGAGGTGCACCACATTCCGTAATCGTCTCTACAATGAGAACAACATTAATGCATCGTTTGCTGCGGCATTGAGACCGAATTGTCCATCGAGTG
GTGGTGACAACAATCTCTCACCACTAGACTCTACTGCTACATCTTTCGATAACCGATACTTTAATGATTTGATTAACCAAAGGGGATTACTGCATTCTGATCAAGAGTTGTTTAATGGAG
GTTCGGCGGATGCACAAGTGAGGACCTATAGTTCGAATCCGGCTACTTTTAACCGTGAATTTGCAAGTGCAATGGTGAAGATGAGCAACCTTGGTCCATTAACAGGCTCAAGTGGTCAAG
TTAGGACCAATTGCAGAAGAACGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCATCAACCTTTTCTTCTTTGTTTAAGCTCTCAACTTTTACATTATGTTTATTGGTTTTGTTTGCACCTAGTTCTGGTCAGCTAACTGCCAATTTCTATGCTAGAACGTGCCCA
AATTTCCGTTCTATTATAACTAGAGCTGTCAATACGGCTGTGGCAAATGAAGCTCGCATGGGAGCCTCGTTGCTTCGCCTTCATTTCCATGATTGCTTTGTTAAT
GGATGTGATGCATCC
GTGTTATTGGACGATACCGCGAATTTCACCGGAGAAAAAACAGCAGGCCCGAATAGCAACTCGATTAGAGGTTTCAACGTCATCGATACAATCAAAACCCAATTGGAGCGCCAGTGTCCT
GGTGTTGTTTCTTGTGCGGATATATTAGCTGCGGCTGCTAGAGATTCCGTTGTGGCT
CTTCGTGGGCCTGGGTGGAACGTTTTGTTCGGAAGAAGGGACTCAACAACAGCAAGTTTAAGT
GCTGCAAATTCTAATCTTCCTTCACCAACTTCTAGTCTTAGTACCCTCATTTCATCTTTTTCAAACCAAGGGTTTACTGCTAATGAAATGATAGCTCTATCAG
GAGCTCATACAATTGGT
CAAGCGAGGTGCACCACATTCCGTAATCGTCTCTACAATGAGAACAACATTAATGCATCGTTTGCTGCGGCATTGAGACCGAATTGTCCATCGAGTGGTGGTGACAACAATCTCTCACCA
CTAGACTCTACTGCTACATCTTTCGATAACCGATACTTTAATGATTTGATTAACCAAAGGGGATTACTGCATTCTGATCAAGAGTTGTTTAATGGAGGTTCGGCGGATGCACAAGTGAGG
ACCTATAGTTCGAATCCGGCTACTTTTAACCGTGAATTTGCAAGTGCAATGGTGAAGATGAGCAACCTTGGTCCATTAACAGGCTCAAGTGGTCAAGTTAGGACCAATTGCAGAAGAACG
AATTAA

Retrieve as FASTA