Entry information : HaPrx12 ( HanXRQChr10g0296251)
Entry ID 1482
Creation 2007-09-06 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx12 ( HanXRQChr10g0296251)
Name (synonym) HaPrx12 ( HanXRQChr10g0296251)
Class Class III peroxidase    [Orthogroup: Prx104]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx12
start..stop
S start..stop
HaPrx20 586 0 1..330 1..330
HaPrx37 585 0 1..330 1..334
HaPrx21 523 0 1..330 43..376
HaPrx[P]76 511 0 1..330 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 117747931..117748341 411 N° 2 117747666..117747828 163 N° 3 117747160..117747578 419  
complement(join(117747160..117747578,117747666..117747828,117747931..117748341))


exon

Literature and cross-references HaPrx12 ( HanXRQChr10g0296251)
Literature Kozik,A., Michelmore,R.W., Knapp,S., Matvienko,M., Rieseberg,L., Lin,H., van Damme,M., Lavelle,D., Chevalier,P., Ziegle,J., Ellison ,P., Kolkman,J., Slabaugh,M.S., Livingston,K., Zhou,Y., Lai,Z., Church,S., Jackson,L. and Bradford,K. Lettuce and Sunflower ESTs from the Compositae Genome Project Unpublished (2002).
DNA ref. HanXRQ genome:   HanXRQChr10 (117748341..117747160)
EST ref. GenBank:   BQ968010.1 [3' end]
Protein sequence: HaPrx12 ( HanXRQChr10g0296251)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330
PWM (Da):   %s   35329.14 Transmb domain:   %s   i12-29o
PI (pH):   %s   9.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEASSLSKTGILLVLLLAILTNFALGQGYRGTRVGFYKSTCPRVESIVQSAVESAVRANQTIAPGLLRMFFHDCFINGCDASILINGSSTEKSAGPNAFLRGFEVIDAAKSQLEKDCPGVVSCSDILALAARDSVVLTGGHSWQVPLGRRDGLVSRGSDTANLPASNDSISVQIKKFADKGLDIQDLVTLVGGHTIGTAACGVFSYRLYNFNNTNRPDPDINSSFLPQLRALCPNGGNASRRVALDTGSVNSFGESFYANLKYGRGVIESDAKLWSDPTTQRFVKRFLGSRGLHGLRFDVEFGRAMVKMGNVEVKTGKQGEIRRICTAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST. Strain="ANN1312"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCTTCTTCCCTTAGCAAAACAGGCATCTTGTTGGTTCTCCTGTTAGCCATACTCACAAACTTTGCACTAGGCCAAGGCTATAGAGGCACCCGAGTTGGCTTCTACAAGTCCACC
TGCCCTCGGGTGGAGTCCATAGTCCAATCTGCAGTTGAGTCTGCGGTCCGAGCCAACCAAACAATCGCACCTGGTTTACTAAGGATGTTCTTCCATGACTGCTTTATCAATGGTTGTGAT
GCATCCATACTTATTAATGGATCCTCAACTGAGAAGTCAGCAGGCCCAAACGCTTTCTTGAGGGGCTTTGAAGTTATTGATGCTGCGAAGTCTCAGCTCGAAAAGGACTGCCCTGGAGTG
GTCTCTTGTTCCGATATTCTTGCCCTTGCTGCCCGTGATTCTGTGGTCCTG
GTAATCAAATGCTTTCTTACATTTGTTCTAGTTTAAGAACATATAGTTAACTGCTTAATTGTGTTGTTT
TATCGTTAATTTTCACTGTATGACATATTGCAGACCGGGGGGCATAGTTGGCAGGTGCCATTAGGACGTAGAGACGGATTGGTTTCTCGAGGTTCTGATACCGCAAACTTGCCCGCTTCT
AATGACTCTATAAGTGTCCAAATCAAAAAGTTTGCGGATAAAGGTCTTGACATTCAAGATCTTGTAACTCTTGTTG
GTAAGGAGAGCAAAATAACATTGCTACATGTAATTCAAGGATGC
TATTTTAATAATCATAAGTTAAACTGGGTACTTCTTTCTATAGGTGGACATACAATTGGAACAGCAGCTTGTGGAGTATTCAGCTATAGATTATACAACTTCAACAATACCAATAGACCC
GACCCTGATATTAACTCATCATTCCTACCACAGCTACGAGCACTTTGCCCCAATGGTGGTAATGCGTCGAGGCGTGTGGCGCTAGATACAGGTAGCGTTAATAGCTTTGGTGAGTCCTTC
TACGCTAACTTAAAGTACGGACGCGGAGTTATTGAATCAGATGCAAAGCTATGGAGTGATCCAACAACACAAAGGTTTGTAAAACGGTTCCTTGGATCTAGGGGGCTACATGGATTAAGA
TTCGATGTTGAGTTTGGAAGAGCCATGGTGAAGATGGGTAATGTTGAGGTGAAGACAGGAAAACAAGGTGAAATTCGTAGAATTTGTACGGCAATCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCTTCTTCCCTTAGCAAAACAGGCATCTTGTTGGTTCTCCTGTTAGCCATACTCACAAACTTTGCACTAGGCCAAGGCTATAGAGGCACCCGAGTTGGCTTCTACAAGTCCACC
TGCCCTCGGGTGGAGTCCATAGTCCAATCTGCAGTTGAGTCTGCGGTCCGAGCCAACCAAACAATCGCACCTGGTTTACTAAGGATGTTCTTCCATGACTGCTTTATCAATGGTTGTGAT
GCATCCATACTTATTAATGGATCCTCAACTGAGAAGTCAGCAGGCCCAAACGCTTTCTTGAGGGGCTTTGAAGTTATTGATGCTGCGAAGTCTCAGCTCGAAAAGGACTGCCCTGGAGTG
GTCTCTTGTTCCGATATTCTTGCCCTTGCTGCCCGTGATTCTGTGGTCCTG
ACCGGGGGGCATAGTTGGCAGGTGCCATTAGGACGTAGAGACGGATTGGTTTCTCGAGGTTCTGATACC
GCAAACTTGCCCGCTTCTAATGACTCTATAAGTGTCCAAATCAAAAAGTTTGCGGATAAAGGTCTTGACATTCAAGATCTTGTAACTCTTGTTG
GTGGACATACAATTGGAACAGCAGCT
TGTGGAGTATTCAGCTATAGATTATACAACTTCAACAATACCAATAGACCCGACCCTGATATTAACTCATCATTCCTACCACAGCTACGAGCACTTTGCCCCAATGGTGGTAATGCGTCG
AGGCGTGTGGCGCTAGATACAGGTAGCGTTAATAGCTTTGGTGAGTCCTTCTACGCTAACTTAAAGTACGGACGCGGAGTTATTGAATCAGATGCAAAGCTATGGAGTGATCCAACAACA
CAAAGGTTTGTAAAACGGTTCCTTGGATCTAGGGGGCTACATGGATTAAGATTCGATGTTGAGTTTGGAAGAGCCATGGTGAAGATGGGTAATGTTGAGGTGAAGACAGGAAAACAAGGT
GAAATTCGTAGAATTTGTACGGCAATCAATTGA

Retrieve as FASTA