Entry information : CsorAPx-R
Entry ID 15183
Creation 2018-04-27 (Christophe Dunand)
Last sequence changes 2018-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-04-27 (Christophe Dunand)
Peroxidase information: CsorAPx-R
Name CsorAPx-R
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Chlorophyta Trebouxiophyceae Chlorellaceae Chlorella
Organism Chlorella sorokiniana    [TaxId: 3076 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsorAPx-R
start..stop
S start..stop
CvarAPx-R 384 2e-134 37..319 68..350
CreAPx-R 287 2e-96 78..319 92..337
EUgAPx-R01 250 3e-83 89..315 4..235
VcaAPx-R 251 2e-82 85..319 89..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 86994..87087 94 N° 2 86687..86898 212 N° 3 86482..86518 37 N° 4 86231..86324 94
N° 5 85798..85921 124 N° 6 85447..85549 103 N° 7 85268..85311 44 N° 8 84964..85072 109
N° 9 84593..84735 143  
complement(join(84593..84735,84964..85072,85268..85311,85447..85549,85798..85921 ,86231..86324,86482..86518,86687..86898,86994..87087))


exon

Literature and cross-references CsorAPx-R
Protein sequence: CsorAPx-R
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319
PWM (Da):   %s   33289.14 Transmb domain:   %s   i52-74o
PI (pH):   %s   7.63
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQQAAHRPAQCGAAPNPARRQQAAVVHCSSAGAQPPSQQVAAAPSRRQLLRLAAGLPALALLPALAAPLPAAAAAAPGPRYLTPEEQAAVDAAFAATLPKAAPVIVRLVFHDAGSYSAAAGNGGVNASIQYELDRPDNFGLKRGWNVIEATAKKLQGTAAEGLSRADLIALAGAHAVRITGGPQIVAVGRQDATAADPDGRMPELDSSAEQLLDNFAAKGLSARELIVLSGSHLGSKGYGDPVTFDNTYYKTLLDKPWERVSAEMAAHIGIPTDHVLPDNPTCRPFIEEYAADQQLFFRDFAAAFAKMTELGARWA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAAGCGGCCCACAGGCCAGCCCAGTGCGGCGCGGCACCCAACCCCGCCCGGCGGCAGCAGGCGGCCGTGGTGCATTGCAGCAGCGCTGGTGAGGAGCCTGGCAGTGCCGATGTG
GCGCGATCGTCCCCCTCCGACGGCCTGTACCTGCACACCCACCCGGCTCACCCTGCTGCACCCTTGCAGGCGCCCAGCCGCCCTCGCAGCAGGTTGCAGCAGCGCCCAGCAGACGCCAGC
TGCTGCGGCTGGCCGCGGGGCTGCCGGCTCTGGCCCTGCTGCCGGCGCTGGCGGCGCCGCTGCCTGCCGCCGCTGCCGCTGCACCTGGGCCACGCTACCTCACCCCTGAGGAGCAAGCGG
CCGTGGATGCCGCCTTTGCCGCCACGCTGCCCAAGGCCAAG
GTGTGCTTGGGGAGGGATAGGTGCATTGACGGCTGATGCTTTGGGCAGGCAGTGTACCTTTGCCACGGGTTGCCGCCGC
TGCAAGCTGTCTTCCATCCTTGCACCCTTGCTGCGCGATGCACGGACCCTTACCAACCGTTCCATGCTCTGGCTTGGCCGTGAATGCAGGCCCCCGTCATAGTCCGCCTGGTGTTCCACG
ACGCCG
GTGAGGGTGGAAAGCAGGCAGGCTGCTGTGCTGGCAGGTGTTCAAGGATGGTGCAGCTGCCGAGGGGCATGCTGCCGGCTGCTGCTTGCCTGCTCAACCCTCCCCTGCACACGC
CCCGCTTTGCTTGCTTTGCTTGCTTTGCCCCGGCTGCTGCCAGGCTCCTACAGCGCGGCAGCGGGCAATGGCGGCGTGAATGCCTCCATCCAATACGAGCTGGACCGGCCCGACAACTTT
GGGTTGAAGCGCGGCTG
GTGAGGGGGGAGCGGGGCAGGGGCAGGGGCAGGGGTGGCAGAGTGCTGGGCAGGGGTGGGACCTGGGGTGCTGGCCAGCTGCAGGGATGTGCAGACAGGGCTG
CGAGGGATAAAACAGCAGCGCTGCAGGCTGGTCGGCTGATTCGGGGCTCGTACCAGGCCCGGGGGTCGCGCCTGCTGGTACGCATACCAGCGGCGCCTTTACCCGCGCCCTGCCGGACCA
ATGTTTCCAAGCCAGCCTGCACATATCCCCCTCCTCGCTGCTGTGCATGCAATAATTCATCTGCCGCACCCTCGCTGTTGGTGCAGGAACGTGATTGAGGCGACAGCCAAGAAGCTGCAG
GGCACTGCGGCAGAGGGCCTGTCTCGCGCCGACCTGATTGCGCTGGCGGGGGCGCATGCTGTGCGCATCACCGGCGGCCCGCAGATCAAG
GTGGGGGAGGGTGACGAAGAGGGGGTGACT
GCATGTAAGTGATGGGGCAAGGCGAAAAGTGGATGTGGTGGTGACTGTAGGTGCTGTGGGCGTCACGCGCTGAGGTAGGCTTGCAAATCAGGCAGGCTGGCCAGGCCTGCAGGCATGCAT
GAGCGGCTGCCGCGCTGTTCAGCTTGGCTTGTACCTGCCCCTGCTTTCTTGCTCAGTAATCCAGGCACCGCCGTACCCCTGCACCCTCCTCCCTGCAGGTGGCAGTGGGGCGGCAGGATG
CGACGGCAGCCGACCCTGATGGCCGCATGCCGGAGCTGGACTCGAGCGCTGAGCAGCTGCTGGACAACTTTGCGGCAAAAG
GCGCGCTGGCCAGCTGGCGGCCTTGCGTCTGGCTGGTCG
GCTGCTTTGGAGGTGCCAACGTCTTCTGCATGCACGTGTGCGTTGTTTTTTCAGCCGGTCTGACCTGCGCCTGGATGCATCCCTCCCCATGTGCAGGCCTGTCGGCGCGCGAGCTGATTG
TGCTGTCGGGGTCGCACACG
GTGAGGCGGAGGCTCTGGCCTCTTGGCGCAGCCACGCCATGCCATTTGCTTGCAGCCGTAATGCTTGATGTCGCCTGTCGCTGCCCGCACGGCTGCTAAC
TGGGCAGGAAGGGTTCTGACGATCCGCTCGTCATGCGCAACGCCCCTGTTGCCTGACACACTGCCTGGCTGCTCTCATTGCCTGCTCTGCCGCAGCTGGGCAGCAAGGGGTACGGCGATC
CGGTGACCTTTGACAACACCTACTACAAGACGCTGCTGGATAAACCTTGGGAGCGCGTCAGCGCCGAGATGGCGGCACACATTG
GTGGGTGCGCTGTGCTGTCTCTGGCTGGGCTGGGTG
CGGTGTTGGGGGGCCGCAATAGCGTCCGGCAGAGCTGGCTGTTGTAGTGCAGTGACGGGCTGGAGGGCAGGGGTCCTCATCAACCACGGTCAGCCTGGTAGATTGTTGCTGCCAGCCTGA
TGTTGTCCAACCGCTCGTTGCCAACCATTAGCCACCCCTCTCATGCACCCACTTCCGACCTCTCCGCCGCAGGCATCCCCACCGACCATGTTCTGCCGGACAACCCCACCTGCCGCCCCT
TCATTGAGGAGTATGCGGCGGACCAGCAGCTCTTCTTCCGCGACTTTGCGGCCGCGTTTGCCAAGATGACGGAGCTGGGAGCGCGCTGGGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAAGCGGCCCACAGGCCAGCCCAGTGCGGCGCGGCACCCAACCCCGCCCGGCGGCAGCAGGCGGCCGTGGTGCATTGCAGCAGCGCTGGCGCCCAGCCGCCCTCGCAGCAGGTT
GCAGCAGCGCCCAGCAGACGCCAGCTGCTGCGGCTGGCCGCGGGGCTGCCGGCTCTGGCCCTGCTGCCGGCGCTGGCGGCGCCGCTGCCTGCCGCCGCTGCCGCTGCACCTGGGCCACGC
TACCTCACCCCTGAGGAGCAAGCGGCCGTGGATGCCGCCTTTGCCGCCACGCTGCCCAAGGCCAAG
GCCCCCGTCATAGTCCGCCTGGTGTTCCACGACGCCGGCTCCTACAGCGCGGCA
GCGGGCAATGGCGGCGTGAATGCCTCCATCCAATACGAGCTGGACCGGCCCGACAACTTTGGGTTGAAGCGCGGCTG
GAACGTGATTGAGGCGACAGCCAAGAAGCTGCAGGGCACTGCG
GCAGAGGGCCTGTCTCGCGCCGACCTGATTGCGCTGGCGGGGGCGCATGCTGTGCGCATCACCGGCGGCCCGCAGATCAAG
GTGGCAGTGGGGCGGCAGGATGCGACGGCAGCCGACCCT
GATGGCCGCATGCCGGAGCTGGACTCGAGCGCTGAGCAGCTGCTGGACAACTTTGCGGCAAAAG
GCCTGTCGGCGCGCGAGCTGATTGTGCTGTCGGGGTCGCACACGCTGGGCAGCAAG
GGGTACGGCGATCCGGTGACCTTTGACAACACCTACTACAAGACGCTGCTGGATAAACCTTGGGAGCGCGTCAGCGCCGAGATGGCGGCACACATTG
GCATCCCCACCGACCATGTTCTG
CCGGACAACCCCACCTGCCGCCCCTTCATTGAGGAGTATGCGGCGGACCAGCAGCTCTTCTTCCGCGACTTTGCGGCCGCGTTTGCCAAGATGACGGAGCTGGGAGCGCGCTGGGCATGA

Retrieve as FASTA