Entry information : CsorAPx02
Entry ID 15185
Creation 2018-04-27 (Christophe Dunand)
Last sequence changes 2018-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-04-27 (Christophe Dunand)
Peroxidase information: CsorAPx02
Name CsorAPx02
Class Ascorbate peroxidase    [Orthogroup: APx009]
Taxonomy Eukaryota Viridiplantae Chlorophyta Trebouxiophyceae Chlorellaceae Chlorella
Organism Chlorella sorokiniana    [TaxId: 3076 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsorAPx02
start..stop
S start..stop
CsorAPx05 291 1e-92 366..707 22..341
CsorAPx03 159 2e-43 439..700 75..351
CsorAPx04 133 1e-34 363..700 18..339
KflAPx-R02 107 6e-26 471..691 90..300
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 597628..598087 460 N° 2 597345..597446 102 N° 3 596917..597160 244 N° 4 596603..596714 112
N° 5 596348..596401 54 N° 6 595303..595512 210 N° 7 595097..595147 51 N° 8 594902..594958 57
N° 9 594558..594598 41 N° 10 594285..594393 109 N° 11 594057..594124 68 N° 12 593838..593867 30
N° 13 593327..593618 292 N° 14 593029..593116 88 N° 15 592698..592774 77 N° 16 592423..592512 90
N° 17 592223..592255 33 N° 18 591753..591782 30  
complement(join(591753..591782,592223..592255,592423..592512,592698..592774,5930 29..593116,593327..593618,593838..593867,594057..594124,594285..594393,594558..5 94598,594902..594958,595097..595147,595303..595512,596348..596401,596603..596714 ,596917..597160,597345..597446,597628..598087))


exon

Literature and cross-references CsorAPx02
Protein sequence: CsorAPx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   715
PWM (Da):   %s   74063.69  
PI (pH):   %s   7.34
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPRAKKQTGGLFLGVSPWQDASKAQEEADVEPSDEQQPGCSVVELPLVVGAAAAAAAPAAGPASMPIDSKLAAAPAAPAAAPSGGWQAKKRKPAADEAQASGAMAAEPGGSSCPLATHPSAGAAGGEQPPAEPAPLELEGTAYLALLPNGSITGHLVCPPSIFRPGRRSFGLMAEAVLAGRECTRDAALRTHAASSHPADWGVLRLTLINFSPPPAGAAGQPAGGDPGAAAAGGGGGAAGARAGAGARGGPAEVSLLVERTEGDAMRLRAPVPWQGIELESLPELDAPCTCASSAPGLSLDFRCQLMEGPAADALLGRLQPSLVFVPPATSLPFEPTPSAAMSLSARLSLLCLTVLLAGGAAQAACPFAALARGAGSSSPHSRKLAQTGFNPQLFQPPNVPVDPVLPGQNTNPRCIGGTIENLGALGAWKQNAVDAIVKSIAKEVIWYSADPKFPGTGGPGAPNPTVPMGGLLRAAFHCGTYDRQARTGGCNGSFRFEFNDIVNQDLLNPNFFFVDKLITRWRAEINRRLALNKAVPAGTKISWADTTVLAGASAVIATGGPVTLWDKLKLGRADWATRADNTLRLPIRILTFNGVACTFLNMGFTLDLVVLSAGHTLGFADGGKMTADPSKFLGWDYFQLVQGRVALFPTDNALYNFRTRLVDRWASPASKQDFFAAFEQSYIKMTALNVVWRNYPQPAEFLFFQPSFIT*

Retrieve as FASTA  
Remarks Two predicted isoforms
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCGCGCCAAAAAACAAACTGGGGGCCTGTTTCTGGGCGTCTCGCCCTGGCAGGATGCCTCCAAGGCGCAGGAGGAAGCCGATGTTGAGCCATCTGATGAGCAGCAGCCCGGCTGC
AGCGTCGTGGAGCTGCCGCTGGTGGTTGGCGCCGCCGCCGCCGCCGCCGCTCCAGCCGCCGGCCCCGCCAGCATGCCCATAGATTCCAAGCTGGCTGCGGCGCCCGCAGCGCCCGCAGCC
GCACCCAGTGGCGGCTGGCAGGCCAAGAAGCGCAAGCCGGCAGCGGATGAGGCGCAGGCTAGCGGCGCCATGGCCGCTGAGCCTGGCGGCAGCTCATGCCCTCTGGCGACCCATCCGTCC
GCTGGTGCGGCAGGCGGGGAGCAGCCACCGGCAGAGCCCGCCCCGCTTGAACTGGAAGGCACGGCATACCTCGCGCTGCTGCCCAACGGCAGCATCACAG
GTGGGACCTGGCTGCGGGTG
GGCGCTCTGCAGTGCCTCACAGCGGCTGCTCCTCGCAGCTGTTGCATTTCCCGGCATGCCTTCTGAGGCCGAGCTTGTGTCCCACTCTGAGAAACTGATACTATCATCCGCCTGCCAGCA
TCTTACCCTAGCTTAGCTCGTCCCCGCTCCATGCCTGCCAGGCCACCTGGTGTGCCCTCCCTCTATCTTCCGCCCGGGCCGCCGCTCATTTGGGCTCATGGCTGAGGCAGTGCTGGCCGG
GCGCGAGTGCACGCGGGACGCAG
GCAAGCATGCGTGTGTTTGAGGGAGGGGGGGGGGGGGGGGCGCGGCAGGGCTTGTACCCAGCTTGCAGAAGCTCTGCAGCTGCGGTTGAGGGTGACA
GGTTGAGTTCCTCTGAGTGTGCAGCGTTTCGCTGCCGGCTCCAAAACACAACAAAGCTGCTCTGCTCACCCCTGCTGTGTTGCACAGCACTGCGCACACACGCTGCCTCCTCGCACCCTG
CAGACTGGGGCGTGCTGCGCCTCACTCTCATCAACTTCTCGCCGCCGCCAGCTGGCGCTGCCGGCCAGCCTGCCGGTGGGGACCCTGGGGCGGCGGCAGCTGGCGGCGGCGGTGGGGCGG
CAGGAGCAAGGGCAGGAGCTGGAGCAAGGGGTGGCCCTGCGGAGGTGTCGCTCCTGGTGGAGCGCACAGAGGGAGATGCCATGCGCCTCAG
GTGCGCCGTCTGGCTCCAAGGGGCTACCC
GTCAAGTGCTTGGTGCAAACCAGACGGATGCGTTGCAGCCCTGGAGCGCGCCTCATGGCTCCCCATGCCCTGTCAGCAATTGAAGTCAGTGCCAGCGCCCTGTTTGGTGCTGTGGCAGGG
TTTCTTTTTCCATGGCCAGGAGCGGAATCTTCCCACATGCCCGTCCCATGCAGGGCGCCGGTGCCATGGCAGGGCATCGAGCTAGAGAGTTTGCCGGAGCTGGATGCGCCCTGCACCTGC
GCCAGCTCAGCGCCCGGCCTCTCGCTCGACTTTCGATGCCAGCAG
GTGGGGGGGCGACTGTTAGGTGGTCGGGGTTGGTGCACAGGGCATGGTGAGGCGCATGGGGGCAGCGTTTGCGTG
GCGTGAACTCGGCATGCGTATGCGGCGTGATTAGCCCCCTGCATGCACACTTGCATCCCGACATGCTGCTGCTTCTGAGAATACGCTGGCTGCAAACCGTCTGCTCGCTGCTGCCAACCA
CCACAGCTCATGGAGGGCCCTGCTGCGGATGCGCTGCTGGGGCGGCTGCAGCCTTCACTGGTAGGCCGCGGCGCGCTGCTAAATGTGGGAGAGATGCGCCTCACCCTCCCGCCGGACGCT
GCCGCCATCCTGCTGCCCGGCCACGGCACCGCAGCAACAACAGCAAGGCGTCCAGCAGGGGATGGGGCTGCAGGCGGCGCGCCGCGCCAGTTGGGCGGCGGGGCGGCAGCGGGCGGCAGC
GGGGCACAGGGCGGGCACACGCCGCCGCCACGCCAGCAGCGCATGACCGGAGCGGGCAGCGGCGGCGGGCGCGTGGTGGCTGATAGTGACGACTGGTGATGCTGCCAGCTGCAGCAGGCT
GTCAAACTTGCTGCTGACAACAATGTAAGTGGCCAGCATGGTGCGTGGCCGGCTCGACCAAAATAGCAGAGCGTTGGTGGTGCCACTGGCAGGAGGGCAGCGGACTGACTGTCTTGACGG
GCATGGCCTTCAAGTTGCTGGTTTTTCTAGGTGCACAGCAGGGGTTGTTGAATGCACATCAGCACACACTGCAAGGGAGCGCATGCGTGCAGGCGAGCGAGGCAGCTGCCACCCTACCGC
CACCAGCGGAGCGATCCGATTAGCCCTCTGCTGGGAGCTCCGTGGGCCCTGAAAGGCTGGAATCTGTCCTCCATGACTGGCAAAGCTGACTAACTCCCATGGGTTGCCGTGCTATAGTGT
AGGAATGGCATGGGCAGGGCTTGCTTGCTTGCCTCGGCGGAGGCTCGGGACCGGCAGCTGCCGGCGGCAGGGGAGTCGGGTCGGGCGAACAGGGCTGGATGGAACTGCTCGAGCCGGTTC
GCTACCATCCATTTTGGCTCAATTGGTCTTCTGCATCGGCACAATCGCTTTGAAGGTGTTCGTCCCGCCCGCCACCTCCCTACCGTTCGAGCCGACGCCAAGCGCGGCCATGTCGCTCTC
TGCGCGCCTCTCGCTGCTCTGCCTAACCGTGCTGCTGGCTGGCGGCGCAGCACAGGCCGCCTGCCCCTTCGCGGCGCTGGCCAGGGGTGCGGGGTCGTCCTCACCTCACTCCCGCAAGCT
GGCCCAGACCGGCTTCAACCCTCAA
GTGTGTTGCGGGGTCGTCAGGGAGGTCCAATTGAGCGCCAATCAGCCAAAAGCATCTCTGCCGGCTGCCGCCGCTTTTCCCGCCGCCGCCGCTGC
AAATCCGCTCTGCCCTAGTTCAAATCCTCACACCTACCAACCCCCTCCACCTTGCCCCAGCTGTTTCAACCCCCGAACGTTCCCGTGGACCCCGTGCTCCCCGGCCAGAATGTGAGTACA
TAGCTCCGGGCGGTGGCATCAACCGCTGCGTTGTGACCGCCGCTCTACACAGCCCCGGGGCCCGGGCGTGTCTGTCCGCCTGCGTCGCCCTTCGACCCGCACCACCTGCCGCTCACCCGC
GCGCTGCAGACAAACCCGCGCTGCATTGGTGGCACGATCGAGAACCTGGGTGCGCTGGGGGCATGGGTGGCCTGCTGCAGATGTGAAGCGGCACTTGCCGCGGGGGGGACTTGCGGCACG
CTCGCACGGCAGCGGCGTGCGTTGCAGTGGCAAGGCATGGGTGCCCAAGGGCTAGTCGATGCACAGTGCCACTCCACCTGCAAGCGGCAGTGCACTGGAAATCCGCGCAGAGCTGACAAC
TGATGAAGCCTGGTCTCTCAGTGCCCCGCCCTCGTCAACTGCCATTTTGCGCATGCCACCCACTGCCTGCCGCCCCTGTCTGCTCCCTACAGATGCCCGCAACGCTGCCAACCCGCCGCC
GTGATCCAGAAGCAGAATGCTGTGGACGCCATCGTGAAGAGCATCGCCAAGTGAGGGGCAATCAACCTTTGCGCAAGCCTGCGGTCAACAACTGCCCTTGGTGCCCCGCTCTGCCCCGCG
GGGGCGGCCGCATGTGCTGCGCAGGCCTGCCCGTCAGCAGCCATGGTGCGACCTGTTGCACTGTGTTATCCCTTCCACGCTTCGCATTGTGCAGGGAGGTCATCTGGTACAGCGCTGACC
CCAAGTTCCCCGGCACTGGCGGCCCCGGCGCGCCCAACCCAACCGTTCCCATGGGCGGCCTGCTGCGGGCTGCATTCCACGAG
GTGCTTACGATGCGCCCGCTGTGCTGCGCCTGCGCGG
GCCTGGAAATCGGCGGCGCCAAGCAAATGGTGTACTGAACAGCATGTGTTGACAGCATTGCGTCCCTCCACGAAAAGTGCGGATCTAACCACACCCACTGCCCCCACCCCTCCGCCCAAG
CAGTGCGGCACGTACGATCGCCAGGCGCGCACGGGCGGCTGCAACGGCAGCTTCCGCTTCGAGTTCAACGAGTGAGTGCTTGCTAGTGTCACCTGGTGTGCATCAACTCTCTAGTGCAAG
CACTGTCGACATGAGGATGCTGCGCAAGGGACCTGAGTATTCTGCTGCGGCAATGGGGGTGCGCCCTGTCGACAGACCTGCGGCACTGCCGCTTGCTGCCCCCTGATGGCGGCCCTCTGT
GTTCTTATCTGGTGCCGCAGCATCGTGAACCAGGACCTGCTGAACCCCAAGTGAGAGAGCTGCCATGACTGCGCACCGCACCTTGCTGCGTCGGTCAAGCGTAGCAGCGGCGGCGGCGGT
TGCCTAGCTGGCGCCTCCATTCAGCCCCCCTGCCGCTGTGCTGCCACAGCCGCTCGCACTTGAGCCGCCTACCGCCCCACTTGCTGCCCACACTCTTACCCTGCTCGGGAACCCCCCTCT
CCTCCCCTCCCTCTCCTCCTCCCTCCCAGCTTCTTTTTCGTCGACAAGCTGATCACGCGGTGGCGCGCGGAGATCAACCGCCGCCTCGCCCTCAACAAGGCCGTGCCTGCGGGCACCAAA
ATCTCCTGGGCGGACACCACAGTGCTCGCTGGCGCCTCTGCCGTCATTGCCACCGGCGGCCCTGTCACCCTGTGGGACAAGCTGAAGCTGGGCCGTGCAGACTGGGCGACCCGGGCGGAC
AACACGCTGCGCCTGCCCATCCGCATCCTCACCTTCAACGGCGTGGCCTGCACTTTCCTCAACATGGGCTTCACGCTGCAG
GTGCGCGGGGCAGGGGTGGACGCCATCAGCTGCAGGGCT
GGGCAGGGCTTGGTCGTGCGTTGGGTTGACGGCACAGCAGTTGACGTCACAGCAGGGAATTCCGCCAGCTGGTGGACGGCAGATGCGGCGCCTGATATGCAGCGCCCCTGCAACTATTCT
AGCGTTCACATGCCTCCCACGTGGACGCACACACTCTGCCGCCCCCGGCAGGATCTGGTGGTGCTGTCTGCCGGCCACACCCTGGGCTTTGCCGACGGCGGCAAGATGACGGCCGACCCC
TCGAAGTTCCTGGGCTGGG
GTGAGGCTGCATGTGTGTGATGGAAAGCTGCAGTTGCTGTTCGATAACGAGCTCCCAACCCACACTCGGTCCAAGAGAGTGCCTCGCCCAACCGCCCCTGC
ATTACTCTGTGCAAAATGGCGACAGACGACTCTGCTCCTTCCTTTTCCCCGCCCAGCAGACTACCTCCAGCTGGTGTGTTGGTACCAGTGCAAAAATGCTGCTGGACGCGTGTGCAGTCA
ACAATACCTGCCCTCCCTCCCCCCGCCCCGCAGACTACTTCCAGCTGGTGCAGGGCCGGGTGGCACTCTTCCCCACTGACAACGCGCTCTACAACTTCCGCACCCGCCCCGTGAGGGCCC
TGCCGTTTGCTGCCTGCTGCCGCTGTGCGGCCTGATCCTGACCAGCAGCGCTGCCGCCGCTGTAGCTTGCCACAGCGCCGCACCCGCTGGGAGCAGGAGAACGAGTGTTTGGCGCTCCAG
CAGCTTTGTGAAGCCAGCTCCTTTTTACCCACCCGCCCTCCTGCCTGGCGTGCAGCTGGTGGACCGCTGGGCCAGCCCCGCCAGCAAGCAGGACTTCTTTGCCGCCTTTGAGCAGTCGTA
CATCAAGATGACGGCCCTGAATGTG
GTGGGTAGGGGGAAACGCCGCTGATGCAAACGGCGGTCTGGGCCCTGCTGTCACTCCTGAACTGCAGCGCTCGCCTCCTGGCAGCAGCATGCTGT
GCTTGAGCTTTACATTGACATCCAGATGACTGAGCTGCCCGTCCCATCGTTGGTGTTGCTCGCTAATCACAGGTGTGGCGCAACTACCCCCAGCCTGCTGAGTTTGTGAGGGCTTGAGGC
TTGAGCTGAGCTGCCGGCTTCTCTCGGCGGCTGCGGCGTTCCTGAAGGCTATCCACACAGCAAGCAGCGGCACTGTTGCGCACTTGACCCAACTCGACCACGGCATGACCATTCAGCTGC
TGCCGCCACCGCAGCAGCGGCGGCGCTCTGGCACCTACTTACAGGCATCCAGCGGGTTGATCCGCTCGGCATTCTGAAAGTAGCGGCCAGCCGCTGCACAAACCCGCCTTTGCTTGCGCA
CACTAGCAGTCCCTGGTTGTTGAGGCGCTCCTCCCAGAGAGCATTTGCTGATATCCCATCTCCCTTGCCCTGACTCCTCTGCGACCGTTCCCCCGATCTGAATCGACCGACCCTGCCCTG
CCACAACACTTTCCCAAAACCCAACACCGCCTGCAACCTCCCAAACCGTATCTTTTTCTGCACAGCTTTTCTTCCAACCTTCTTTCATCACTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCGCGCCAAAAAACAAACTGGGGGCCTGTTTCTGGGCGTCTCGCCCTGGCAGGATGCCTCCAAGGCGCAGGAGGAAGCCGATGTTGAGCCATCTGATGAGCAGCAGCCCGGCTGC
AGCGTCGTGGAGCTGCCGCTGGTGGTTGGCGCCGCCGCCGCCGCCGCCGCTCCAGCCGCCGGCCCCGCCAGCATGCCCATAGATTCCAAGCTGGCTGCGGCGCCCGCAGCGCCCGCAGCC
GCACCCAGTGGCGGCTGGCAGGCCAAGAAGCGCAAGCCGGCAGCGGATGAGGCGCAGGCTAGCGGCGCCATGGCCGCTGAGCCTGGCGGCAGCTCATGCCCTCTGGCGACCCATCCGTCC
GCTGGTGCGGCAGGCGGGGAGCAGCCACCGGCAGAGCCCGCCCCGCTTGAACTGGAAGGCACGGCATACCTCGCGCTGCTGCCCAACGGCAGCATCACAG
GCCACCTGGTGTGCCCTCCC
TCTATCTTCCGCCCGGGCCGCCGCTCATTTGGGCTCATGGCTGAGGCAGTGCTGGCCGGGCGCGAGTGCACGCGGGACGCAG
CACTGCGCACACACGCTGCCTCCTCGCACCCTGCAGAC
TGGGGCGTGCTGCGCCTCACTCTCATCAACTTCTCGCCGCCGCCAGCTGGCGCTGCCGGCCAGCCTGCCGGTGGGGACCCTGGGGCGGCGGCAGCTGGCGGCGGCGGTGGGGCGGCAGGA
GCAAGGGCAGGAGCTGGAGCAAGGGGTGGCCCTGCGGAGGTGTCGCTCCTGGTGGAGCGCACAGAGGGAGATGCCATGCGCCTCAG
GGCGCCGGTGCCATGGCAGGGCATCGAGCTAGAG
AGTTTGCCGGAGCTGGATGCGCCCTGCACCTGCGCCAGCTCAGCGCCCGGCCTCTCGCTCGACTTTCGATGCCAGCAG
CTCATGGAGGGCCCTGCTGCGGATGCGCTGCTGGGGCGGCTG
CAGCCTTCACTG
GTGTTCGTCCCGCCCGCCACCTCCCTACCGTTCGAGCCGACGCCAAGCGCGGCCATGTCGCTCTCTGCGCGCCTCTCGCTGCTCTGCCTAACCGTGCTGCTGGCTGGC
GGCGCAGCACAGGCCGCCTGCCCCTTCGCGGCGCTGGCCAGGGGTGCGGGGTCGTCCTCACCTCACTCCCGCAAGCTGGCCCAGACCGGCTTCAACCCTCAA
CTGTTTCAACCCCCGAAC
GTTCCCGTGGACCCCGTGCTCCCCGGCCAGAAT
ACAAACCCGCGCTGCATTGGTGGCACGATCGAGAACCTGGGTGCGCTGGGGGCATGGAAGCAGAATGCTGTGGACGCCATCGTGAAG
AGCATCGCCAA
GGAGGTCATCTGGTACAGCGCTGACCCCAAGTTCCCCGGCACTGGCGGCCCCGGCGCGCCCAACCCAACCGTTCCCATGGGCGGCCTGCTGCGGGCTGCATTCCACGAG
TGCGGCACGTACGATCGCCAGGCGCGCACGGGCGGCTGCAACGGCAGCTTCCGCTTCGAGTTCAACGACATCGTGAACCAGGACCTGCTGAACCCCAACTTCTTTTTCGTCGACAAGCTG
ATCACGCGGTGGCGCGCGGAGATCAACCGCCGCCTCGCCCTCAACAAGGCCGTGCCTGCGGGCACCAAAATCTCCTGGGCGGACACCACAGTGCTCGCTGGCGCCTCTGCCGTCATTGCC
ACCGGCGGCCCTGTCACCCTGTGGGACAAGCTGAAGCTGGGCCGTGCAGACTGGGCGACCCGGGCGGACAACACGCTGCGCCTGCCCATCCGCATCCTCACCTTCAACGGCGTGGCCTGC
ACTTTCCTCAACATGGGCTTCACGCTGCAG
GATCTGGTGGTGCTGTCTGCCGGCCACACCCTGGGCTTTGCCGACGGCGGCAAGATGACGGCCGACCCCTCGAAGTTCCTGGGCTGGGAC
TACTTCCAGCTGGTGCAGGGCCGGGTGGCACTCTTCCCCACTGACAACGCGCTCTACAACTTCCGCACCCGCCCC
CTGGTGGACCGCTGGGCCAGCCCCGCCAGCAAGCAGGACTTCTTT
GCCGCCTTTGAGCAGTCGTACATCAAGATGACGGCCCTGAATGTG
GTGTGGCGCAACTACCCCCAGCCTGCTGAGTTTCTTTTCTTCCAACCTTCTTTCATCACTTAA

Retrieve as FASTA