Entry information : CsorAPx04
Entry ID 15187
Creation 2018-04-27 (Christophe Dunand)
Last sequence changes 2018-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-04-27 (Christophe Dunand)
Peroxidase information: CsorAPx04
Name CsorAPx04
Class Ascorbate peroxidase    [Orthogroup: APx009]
Taxonomy Eukaryota Viridiplantae Chlorophyta Trebouxiophyceae Chlorellaceae Chlorella
Organism Chlorella sorokiniana    [TaxId: 3076 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsorAPx04
start..stop
S start..stop
CsorAPx03 196 2e-60 68..339 66..351
CsorAPx05 183 1e-55 22..339 23..334
CsorAPx02 157 3e-43 70..339 432..700
KflAPx-R02 132 3e-36 110..338 90..308
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1490470..1490607 138 N° 2 1490223..1490300 78 N° 3 1489940..1490084 145 N° 4 1489826..1489838 13
N° 5 1489524..1489668 145 N° 6 1489117..1489315 199 N° 7 1488928..1488984 57 N° 8 1488579..1488775 197
N° 9 1488335..1488400 66  
complement(join(1488335..1488400,1488579..1488775,1488928..1488984,1489117..1489 315,1489524..1489668,1489826..1489838,1489940..1490084,1490223..1490300,1490470. .1490607))


exon

Literature and cross-references CsorAPx04
Protein sequence: CsorAPx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   345 (325)
PWM (Da):   %s   36384.64 (34451.5)  
PI (pH):   %s   10.15 (9.89) Peptide Signal:   %s   cut: 21 range:21-345
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRGLAALSLLVLLAVGARAGCPFGFGGGLEDAEGGIKGTGRRLQQAGCNINTLAQQAVTAPFVPANPLQGQVDKYVKEVAWNVFQTGFPGFVPGLFKNGRLNSANVPLGGLLRLSFHDAGPFNRATGRGGANGSLRFELGVKPNTNQNIIIAAGLCDRWRTMINNALAADPVPRGVQISYADVYQLIGAAVVVAAGGPSKAEVYDPLPVGRRDALVADNVAQMPGGGISWNNLACLFLTNGYSLEELVALSGAHELGFRQDRTTPMTANPNSFTNEYFSAVINGARNLFNSDRVLWGNHARSNAAVQTFANNRAAFFTAFAAYNKMGRMGATWQSYGAKLKA*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCCGTGGGCTCGCAGCACTCTCGCTCCTCGTACTCTTGGCGGTCGGCGCCCGGGCGGGATGCCCGTTTGGTTTCGGCGGCGGCTTGGAGGACGCTGAGGGCGGCATCAAGGGCACC
GGGCGGCGCCTGCAGCAG
GTGCCTCTCCCCCGTCTGAACGGGCCAGCGGCCCCGCTGATGTGCAAGCAGCCCCGATTCGCCCTGACACCGTGTCTTCAGCTCAATTCCGCGGCATCTGCG
TGCGGCTGCTTCCGCGGTAGGTCGCCGCCGCTCACCGCCGCCGCTCACTGCTGCTCTCCCCACACAGGCCGGCTGCAACATCAACACCCTGGCGCAGCAGGCAGTAACCGCGCCATTCGT
GCCTGCGAATCCCCTCCAGGGCCAG
GTGCACATGCTGTGGCGACAACTCAAACACTAGCAGTGTGGCAGCCAGGCTGGATTGCAGTGGCGCTCGCCTCGCTCATTGCCAGCCCGCACGTT
GTGGACCCCCTTCCCCTACTAACTGCTCCCTCTCCTTTCCCAGGTGGATAAATATGTCAAGGAGGTCGCCTGGAACGTTTTTCAGACTGGCTTTCCTGGATTCGTGCCCGGACTGTTCAA
GAATGGCAGGCTGAATAGCGCCAATGTGCCGCTGGGCGGGCTGCTCCGCCTGTCGTTCCACGATGCGG
GTACGTGTGCGATGCACAGGTCGCGGTTGGTTGAAATCTGTGGTCGATCCTT
GGTATTGTATGCCCCTTTTTAACCTTCCCGCTTTCCAAACCACTTGCAGGCCCGTTCAACAGGTAAATCTGAGAGGCTGGGAGTGCCCAAGCAACCAAAAAGAGGACAAGGGTGTCGCTT
GAGTCACCGGCGCCTGGCCTGCTTTCCCTAGAGTGTATGCTACAGCGGCTGCCTGATCACAGCCTTGAAACCTCCATCGTTACAACTCTCATGCCACAGGGCAACAGGCCGGGGTGGAGC
CAACGGCAGCCTGCGGTTTGAGCTGGGGGTGAAGCCCAACACCAACCAGAACATCATCATCGCCGCTGGCCTGTGCGACCGCTGGCGCACCATGATCAACAATGCTCTGGCCGCAGACCC
CAAG
GTGCGCCCTAGTCCCAGCAATTGAGCGCATCATCGTCAAACGTTGCTACTGGAAGCATTAGTTGTGGCAAGGCGCAGCTGGCCCCGGCAGTGTTGCACACTGCAGCCGCTCGTCCT
TCTGCAAGCAAGCAACTTGGGACTGACCTTTCAACAGCCTTATTCAGCTAGGCAGCCAAACCATTCACCTTCGTTCCCATGCCAACCTGCAGGTGCCCAGGGGCGTGCAGATTTCCTATG
CTGACGTGTATCAGCTGATTGGCGCAGCGGTGGTGGTTGCAGCCGGCGGCCCCTCCAAGGCTGAGGTGTACGACCCCTTGCCGGTCGGCCGCCGGGACGCCCTGGTTGCCGACAACGTGG
CGCAGATGCCCGGCGGCGGCATCTCTTGGAACAACCTGGCCTGCCTCTTCT
GTGAGTGGCGGGCAGGAGTTGGTTGAAGCTGTAGAACCTGTGCATGAGGACCTCTGGAATGCGAAGACA
GGTGGCGCAGGTGCAGTGGTTGACATGTCCCCGTCCCCTGCCCGCTTTTCTTCTCCCCTGCAGTGACCAACGGCTACTCGCTGGAGGAGCTGGTGGCCCTGTCTGGCGCCCACGAGCTGG
GTGCGCTAAATGCTGAGGGTGCCCAGCAGCCCAACCAAGAACATGCTTGCCCACGCCCACCAACCCGCCTTGCCCGCTATGTCAACTGCTGTACGTGCCGTGTCACTCCTGGCCCTACTC
AGCCAAAACATCATCCTGTGCCCCCGCTGCAGGCTTCCGCCAGGACCGCACCACCCCCATGACCGCCAATCCCAACAGCTTCACCAACGAATACTTCTCTGCCGTGATCAACGGGGCCCG
CAACCTGTTCAACAGCGACCGCGTTCTGTGGGGCAACCACGCCCGCAGCAACGCCGCGGTGCAGACGTTTGCCAACAACCGGGCCGCCTTCTTCACCGCCTTTGCCAAG
GCAAGCTGCTG
CTTGACTGTAAGGGTGGATCTTGGGCAGGCCCACATGGGGAAGATCTTGGATGTCGCTGGCATTCATTAGAAGGGCGCAGACACACTGCATAGTCGGCCGTGCTCTGGGCAGGCATGTCC
CGTCCTCTGCAGCAGCTCCAATATGCACAGCGTCCCATACCCTGCAGGCCTACAACAAGATGGGCCGCATGGGCGCCACCTGGCAGAGCTATGGCGCCAAGCTGAAGGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCCGTGGGCTCGCAGCACTCTCGCTCCTCGTACTCTTGGCGGTCGGCGCCCGGGCGGGATGCCCGTTTGGTTTCGGCGGCGGCTTGGAGGACGCTGAGGGCGGCATCAAGGGCACC
GGGCGGCGCCTGCAGCAG
GCCGGCTGCAACATCAACACCCTGGCGCAGCAGGCAGTAACCGCGCCATTCGTGCCTGCGAATCCCCTCCAGGGCCAGGTGGATAAATATGTCAAGGAGGTC
GCCTGGAACGTTTTTCAGACTGGCTTTCCTGGATTCGTGCCCGGACTGTTCAAGAATGGCAGGCTGAATAGCGCCAATGTGCCGCTGGGCGGGCTGCTCCGCCTGTCGTTCCACGATGCG
G
GCCCGTTCAACAGGGCAACAGGCCGGGGTGGAGCCAACGGCAGCCTGCGGTTTGAGCTGGGGGTGAAGCCCAACACCAACCAGAACATCATCATCGCCGCTGGCCTGTGCGACCGCTGG
CGCACCATGATCAACAATGCTCTGGCCGCAGACCCCAAG
GTGCCCAGGGGCGTGCAGATTTCCTATGCTGACGTGTATCAGCTGATTGGCGCAGCGGTGGTGGTTGCAGCCGGCGGCCCC
TCCAAGGCTGAGGTGTACGACCCCTTGCCGGTCGGCCGCCGGGACGCCCTGGTTGCCGACAACGTGGCGCAGATGCCCGGCGGCGGCATCTCTTGGAACAACCTGGCCTGCCTCTTCT
TG
ACCAACGGCTACTCGCTGGAGGAGCTGGTGGCCCTGTCTGGCGCCCACGAGCTGG
GCTTCCGCCAGGACCGCACCACCCCCATGACCGCCAATCCCAACAGCTTCACCAACGAATACTTC
TCTGCCGTGATCAACGGGGCCCGCAACCTGTTCAACAGCGACCGCGTTCTGTGGGGCAACCACGCCCGCAGCAACGCCGCGGTGCAGACGTTTGCCAACAACCGGGCCGCCTTCTTCACC
GCCTTTGCCAAG
GCCTACAACAAGATGGGCCGCATGGGCGCCACCTGGCAGAGCTATGGCGCCAAGCTGAAGGCCTGA

Retrieve as FASTA