Entry information : StPrx75
Entry ID 16088
Creation 2020-01-11 (Christophe Dunand)
Last sequence changes 2020-01-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-02-20 (Christophe Dunand)
Peroxidase information: StPrx75
Name StPrx75
Class Class III peroxidase     [Orthogroup: Prx024]*
Taxonomy Eukaryota Viridiplantae Streptophyta Solanaceae Solanum
Organism Solanum tuberosum (Potato)    [TaxId: 4113 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value StPrx75
start..stop
S start..stop
LePrx50 696 0 1..347 1..347
CroPrx17 619 0 15..341 1..325
MguPrx88 527 0 9..347 9..341
CroPrx18 523 0 31..347 13..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..246 246 N° 2 1410..1601 192 N° 3 2050..2215 166 N° 4 3178..3617 440
join(1..246,1410..1601,2050..2215,3178..3617)


exon

Literature and cross-references StPrx75
Cluster/Prediction ref. Genebank:   102595116
Protein sequence: StPrx75
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347
PWM (Da):   %s   38295.29  
PI (pH):   %s   6.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFINFCQSKIVIFEFLVLVFIGICFSKLNGISDSHLSLDYYKKTCPSVEGIVRKEMECACLSDPRNAAFILRLHFHDCFVQGCDGSVLLDDTVTLKGEKNAPNNKNALKGFKIIDRIKNRIESECPGTVSCADILTIAARDAVLLVGGPYWDVPLGRKDSIKAGYELADTNLPTADEGLISIISKFISQGLSVTDMVALSGAHTIGKARCVNFRNRIYGDFKMTSTSYINPISSSYLSKLKSLCPPIEINGSSDNNETSMDNITPNLFDNSYYHVLLKGEGLINSDQELYSSYLGIQTKKIVEKYAANTIAFFEQFAESMVKMGNITNQETYVNGEVRKSCRFVNT

Retrieve as FASTA  
Remarks Complete sequence from genomic. No prediction from Phytozome. No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTATTAATTTTTGTCAATCAAAAATTGTGATTTTTGAGTTTTTGGTTTTGGTATTTATTGGCATTTGTTTTAGCAAATTGAATGGAATTAGTGATTCACATTTAAGTCTTGAT
TATTATAAGAAAACATGCCCTTCTGTAGAAGGAATTGTGAGGAAAGAAATGGAATGTGCTTGTCTTTCTGATCCTCGTAATGCTGCTTTCATTTTGAGATTACATTTTCACGATTGCTTT
GTTCAG
GTACGTAAATGAAAATATGAAAATATTATCGATTTAGTTTATTGGAATTATTGAACTGTATGAGCATCTCGTCTAGAAGTTTAACGAATGTTAGAGAAAGGTATACGTAATTCT
GTTATTATGTCTCATGAACACCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCTAAATCTCGAATAATTTACACAAATAGCCACTTTTTTGGCG
GCGTCTTAAGAAATCGACCACTATTTCAAAATGAGATTACTTGTGTGAAGTTTGAAAGTAGCCAAGGTTCAAAACTAGTAGTAATATTTAGAGCATGGGACTAATTTTGAAATGTGGTCA
ACTTTTAAATAAACCACAAAAGTGGTCATCGGATGTAAATTCAACATGAAACACGTGGAATTTTATTTTTTTTGGAAAGATTTGAATATACGATCTTCATTACTTAATTATATTATGTTT
AAACAATCGCTCCTTTCATGTAAACTTGATTCTTTTGCATGAGTCAAACGTAGATTTACACAAATAACCACTTAGTGATAGTCACTTCTTCAAAATTAGACAAGTAGTCAGAAGTCAAAA
TTCAAAACTATTTATATATTCATAGTACATATCTAATTTTGAAAAAGTGGTCAAATTTTAAATACAAACCAAAAAAGTTGTCAATTGGTTTAAAACTTTAAATTCATTCTCAAACACATG
GAAATATTTCGTTTACTTTATAGATGGCAATAAGATTTAAACTTACGACATTTTTATTTGCACTAATATCATGTTGAATTATGTAACAGGGTTGCGATGGCTCGGTATTGTTGGATGATA
CAGTGACATTAAAAGGAGAAAAGAATGCTCCAAACAACAAAAATGCATTAAAAGGATTCAAAATTATTGATAGAATTAAAAATAGAATTGAATCTGAGTGTCCGGGAACTGTTTCTTGTG
CTGATATTCTAACTATTGCTGCTAGAGATGCTGTTCTTCTG
GTAATTATATTCTTGGAATTTTATTTATGATAATATATAATATTATTAAATTATTAGTTTTTAGGTTTCTTTGGTTATT
ATTTAAATAAAATAACCATAATATGAATAAGGGTCGTTTGGGTTCGTATACAGTTAAATCTTTCTATAACGACGTTGTTTGTCTAGAAATGTTGTTAGAACATATAATATATATAACATC
ACAAAAAATATTAGTTCGGATAAAAACTTGACCGTTATAGTGAATCTTATTATAGAAGATGACTGTTATGTAAAGGTCTGACCGTATGCATAACTATAAAATGCATTTTTTTTGTTACAT
TATATTCTTGGAGTGTTGTTTATGGTATTATTAGAATATTAATGTTTAGGTTTTTTAATTATCATCATAGGAATAATTAAAGTTGTATTAATTAATTAATGATTTTTTTAAAATTAATTT
GTGTACTAGGTTGGTGGACCTTATTGGGATGTTCCATTAGGTAGAAAAGACTCAATAAAAGCAGGATATGAATTGGCAGATACAAATCTTCCAACAGCTGATGAAGGATTAATTTCTATT
ATATCTAAGTTTATATCACAAGGACTTTCTGTTACTGATATGGTTGCTCTGTCTG
GTAAGCATTCTTTAATATATATAATCCTCCGTGTCAATTTATATGACACAATTCGTGTTCGATAG
TAAAATATGTGATTTATTCATATGCTTTTTAAATTTTTAATTCTTGTGACTTTTTGTATGTATAGTTATTACGTAGTTTCTATATATGAAAATTATTTTTCAAAAATCTTAAAGAATATA
TGTTTGAATTTACAATCAAAATAAACAAAACACTTCAACTTATAAAATAATCATTTAGACACCTCTAAAATTTTATCCGTCAGATCAACGTCAGGTGTCTACGAGACACAACAAGGACGA
GTTTGAGAGTTTAGTTGTCAATTCTGACCAAGTTAACGTGTACTAGATATACACTTTCAAAGTTGGAGTACTGCTAATTAACGAGGACGAGTTGGACTGTTTAGTTGTTAGTTGAGACTA
AGTCAACGTGTCCTAGATATACACTATCAAAGTTGGAGTACTGCTAATTAACGAGGACGAGTTGGACTGTTTAGTTGTTAGTTGAGACTAAGTCAACGTGTCCTAGATATACACTATCAA
AGTTGGAGTACCACTAATTAACGAGGACGAGTTGAAGTATTTAGTGGTCAGTTGAAACTTCAATCGACTTGTCCTAGATATAAACTTTCAAAGTTAGAGTATTGTTAATTAATGAGGACG
AGTTGGAGTGTTTAATTGTCAGACTAAGTCGACTTGTCCTAGATATACACTTTCAAAGTTGGAGTACTGCTAATTAATGAGGACGAGTTGGGTGTTTAGTTTTCTGTTGAGACCAAGTCG
ACGTGTCCTAAATATACACTTTCAAAGTTGAGTACTGCTTAATTAATTACTTGTCAGTTAAGATCAAATTTGAATGTTTATTTATGTCTTATACAAAAGATTAATTACATGACTTTCTAA
ATTAAGTATTACACAAAATTTATCTTATTTTTAATTAATTGTTTCAAAATTTGGCAGGTGCACATACAATAGGAAAAGCAAGATGTGTGAATTTCAGAAATAGAATATATGGAGATTTCA
AAATGACAAGTACTTCATATATAAATCCAATTTCATCCTCTTATCTTAGTAAATTAAAATCATTATGTCCTCCAATTGAAATTAATGGATCATCAGACAACAATGAAACATCAATGGACA
ATATTACTCCAAATTTATTTGATAATTCATATTATCATGTCTTACTTAAAGGTGAAGGACTCATAAATTCAGATCAAGAACTTTATTCAAGTTATCTTGGAATTCAAACAAAAAAAATTG
TTGAAAAATATGCTGCAAATACAATTGCATTTTTTGAACAATTTGCTGAATCAATGGTCAAAATGGGAAATATTACAAATCAAGAGACTTATGTGAATGGAGAAGTGAGAAAGAGTTGTA
GGTTTGTGAATACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTATTAATTTTTGTCAATCAAAAATTGTGATTTTTGAGTTTTTGGTTTTGGTATTTATTGGCATTTGTTTTAGCAAATTGAATGGAATTAGTGATTCACATTTAAGTCTTGAT
TATTATAAGAAAACATGCCCTTCTGTAGAAGGAATTGTGAGGAAAGAAATGGAATGTGCTTGTCTTTCTGATCCTCGTAATGCTGCTTTCATTTTGAGATTACATTTTCACGATTGCTTT
GTTCAG
GGTTGCGATGGCTCGGTATTGTTGGATGATACAGTGACATTAAAAGGAGAAAAGAATGCTCCAAACAACAAAAATGCATTAAAAGGATTCAAAATTATTGATAGAATTAAAAAT
AGAATTGAATCTGAGTGTCCGGGAACTGTTTCTTGTGCTGATATTCTAACTATTGCTGCTAGAGATGCTGTTCTTCTG
GTTGGTGGACCTTATTGGGATGTTCCATTAGGTAGAAAAGAC
TCAATAAAAGCAGGATATGAATTGGCAGATACAAATCTTCCAACAGCTGATGAAGGATTAATTTCTATTATATCTAAGTTTATATCACAAGGACTTTCTGTTACTGATATGGTTGCTCTG
TCTG
GTGCACATACAATAGGAAAAGCAAGATGTGTGAATTTCAGAAATAGAATATATGGAGATTTCAAAATGACAAGTACTTCATATATAAATCCAATTTCATCCTCTTATCTTAGTAAA
TTAAAATCATTATGTCCTCCAATTGAAATTAATGGATCATCAGACAACAATGAAACATCAATGGACAATATTACTCCAAATTTATTTGATAATTCATATTATCATGTCTTACTTAAAGGT
GAAGGACTCATAAATTCAGATCAAGAACTTTATTCAAGTTATCTTGGAATTCAAACAAAAAAAATTGTTGAAAAATATGCTGCAAATACAATTGCATTTTTTGAACAATTTGCTGAATCA
ATGGTCAAAATGGGAAATATTACAAATCAAGAGACTTATGTGAATGGAGAAGTGAGAAAGAGTTGTAGGTTTGTGAATACATAA

Retrieve as FASTA