Entry information : PtPrx02 (POPTR_0004s01510 / PT04G00330.1 / Potri.004G015300)
Entry ID 1617
Creation 2006-06-07 (Christophe Dunand)
Last sequence changes 2006-06-07 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx02 (POPTR_0004s01510 / PT04G00330.1 / Potri.004G015300)
Name (synonym) PtPrx02 (POPTR_0004s01510 / PT04G00330.1 / Potri.004G015300)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue types Leaves
Stems
Inducers Insect damage (Spodoptera exigua, Meloidogyne, Aphib)
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx02
start..stop
S start..stop
PbPrx03 687 0 1..331 1..331
PbPrx01 687 0 1..331 1..331
PtralPrx01 677 0 1..331 1..331
PtrePrx01 676 0 1..331 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 982348..982578 231 N° 2 982660..982848 189 N° 3 983191..983356 166 N° 4 983468..983877 410
join(982348..982578,982660..982848,983191..983356,983468..983877)


exon

Literature and cross-references PtPrx02 (POPTR_0004s01510 / PT04G00330.1 / Potri.004G015300)
Literature Ralph,S., et al.,. Genomics of hybrid poplar (Populus trichocarpax deltoides) interacting with forest tent caterpillars (Malacosoma disstria):normalized and full-length cDNA libraries, expressed sequence tags, and a cDNA microarray for the study of insect-induced defences Mol. Ecol. 15 (5), 1275-1297 (2006).
DNA ref. Phytozome 12:   Chr04 (982348..983877)
Cluster/Prediction ref. UniGene:   Pth.9838
Omic ref. ePlant:   Potri.004G015300
Protein sequence: PtPrx02 (POPTR_0004s01510 / PT04G00330.1 / Potri.004G015300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (307)
PWM (Da):   %s   37304.06 (34750.7)  
PI (pH):   %s   7.79 (7.52) Peptide Signal:   %s   cut: 25 range:25-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDAKALFFFALLSFSAVSVRPALAENEEDPGLVMNFYKDTCPQAEDIVKEQVRLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRTLSEKETDRSFGLRNFRYFDDIKEAVERECPGVVSCADILVLSARDGIVSLGGPHIPLKTGRRDGRKSRADVIEDYLPDHNESISVVLDRFASMGIDTPGLVALLGAHSVGRTHCVKLVHRLYPEVDPALNPDHVEHMLYKCPDSIPDPKAVQYVRNDRGTPMVLDNNYYRNILDNKGLLIVDHQLATDKRTKPYVKKMAKSQDYFFKEFSRAITILSENNPLTGTKGEIRKQCTVANKHH

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 10 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACA
TGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAG
GTAATTAAG
TCTTGCTTTTATTCCTCTTTTTTGTTTCCGATTTTGTTAGTTCTTGATGATCATGCATGTCTTGTTTTGTAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCC
GAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCT
GCTAGAGATGGCATTGTTTCG
GTACTTCCCTGATTTAAACTTCATCAGTCTTGTCTTTGATTCTTTTAAGCGATTTTTTATCCTCTCTGCTTGGTCTAGAAGAAGGCATGTTTTGGCCAG
ATTGGGCTCTTTTGTAGTTTGCATGGCAACTTTAACTGAATTTGGTGTCTCCAGTTGGAGTCTTTTTCCCTTTCAGGTCACTTAAGACAGGTTTTCTCAGGATATTAGATGCTCTATTTC
TGACAGGATTTGTAATCTTCAGTCTATTTTAGCTTGAATGTAGAGTGACTGCTGAAATTTGTCCAGTACGTACTTTTATAGTAAATGGAAGTTTAATGTGGCCTAAACTTTTCTTGATTT
CAGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGGACTATCTCCCAGACCACAATGAAAGCATATCTGTTGTTCTTGAC
AGGTTTGCTTCCATGGGTATTGACACCCCTGGACTGGTTGCCTTGCTAG
GTATATATATTAACATGTAAACCTCAAATGGTAGCTTTATAGTCATGAATCCAGGTGTCCCCATTACTAAA
AAGTTGGTTTTTTTTTCTTTTTTCTTTTTATGTCCAACAGGAGCTCACAGTGTTGGGAGAACTCACTGTGTGAAGCTGGTGCACCGTTTGTACCCGGAAGTTGACCCAGCACTAAACCCT
GACCATGTTGAGCACATGCTTTACAAGTGCCCTGATTCAATCCCAGACCCTAAAGCTGTCCAATATGTGAGGAATGACAGAGGCACACCCATGGTTCTAGACAACAACTACTACAGAAAC
ATATTGGACAACAAGGGCTTGTTGATAGTGGATCACCAACTAGCCACTGACAAGAGAACTAAGCCTTACGTGAAGAAAATGGCCAAGAGTCAGGATTACTTCTTTAAGGAGTTTTCTAGG
GCTATCACCATTCTTTCTGAGAACAACCCACTCACCGGTACCAAGGGTGAGATCAGAAAGCAGTGCACTGTTGCAAACAAGCACCACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACA
TGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAG
TCATGTGAT
GCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGT
CCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCG
CTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCA
GATGTGATCGAGGACTATCTCCCAGACCACAATGAAAGCATATCTGTTGTTCTTGACAGGTTTGCTTCCATGGGTATTGACACCCCTGGACTGGTTGCCTTGCTAG
GAGCTCACAGTGTT
GGGAGAACTCACTGTGTGAAGCTGGTGCACCGTTTGTACCCGGAAGTTGACCCAGCACTAAACCCTGACCATGTTGAGCACATGCTTTACAAGTGCCCTGATTCAATCCCAGACCCTAAA
GCTGTCCAATATGTGAGGAATGACAGAGGCACACCCATGGTTCTAGACAACAACTACTACAGAAACATATTGGACAACAAGGGCTTGTTGATAGTGGATCACCAACTAGCCACTGACAAG
AGAACTAAGCCTTACGTGAAGAAAATGGCCAAGAGTCAGGATTACTTCTTTAAGGAGTTTTCTAGGGCTATCACCATTCTTTCTGAGAACAACCCACTCACCGGTACCAAGGGTGAGATC
AGAAAGCAGTGCACTGTTGCAAACAAGCACCACTAG

Retrieve as FASTA