Entry information : PandeRboh09(PON36881.1/PanRBOH6)
Entry ID 16247
Creation 2020-03-13 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-10 (Christophe Dunand)
Peroxidase information: PandeRboh09(PON36881.1/PanRBOH6)
Name PandeRboh09(PON36881.1/PanRBOH6)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh002]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Parasponia andersonii    [TaxId: 3476 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PandeRboh09
start..stop
S start..stop
ToriRboh10 1488 0 1..772 5..776
ToriRboh09 1241 0 1..772 69..839
PandeRboh07 1238 0 1..772 69..839
JregRboh08 1203 0 1..772 33..803
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 138625..138781 157 N° 2 138319..138484 166 N° 3 138177..138225 49 N° 4 137956..138069 114
N° 5 137048..137854 807 N° 6 136785..136880 96 N° 7 136578..136693 116 N° 8 136384..136486 103
N° 9 136197..136288 92 N° 10 135956..136115 160 N° 11 135726..135866 141 N° 12 135099..135227 129
N° 13 134918..134996 79 N° 14 134715..134824 110  
complement(join(134715..134824,134918..134996,135099..135227,135726..135866,1359 56..136115,136197..136288,136384..136486,136578..136693,136785..136880,137048..1 37854,137956..138069,138177..138225,138319..138484,138625..138781))


exon

Literature and cross-references PandeRboh09(PON36881.1/PanRBOH6)
Protein sequence: PandeRboh09(PON36881.1/PanRBOH6)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   772
PWM (Da):   %s   88060.82  
PI (pH):   %s   8.55
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSGASKGLTSLRFLDTTLSGKESDTWKPIEDRFNRHAVDGRLFRDNFGACIGMVRESKDFAGELFDALARHRKISAENGITRDELRMFWEDMTNEDLESRLQIFFDMCDKNGDGKLSEEEVKVIVLSASANKLANFKQQAAAYAALIMEKLDPDHLGYIKMWQLETLLKGMVNSEENDDVLKETKSLTKSMIPRKYQTPFSKFISTTKEFIHENWKRIWVITLWLAINLGLFLWKYFQYKNRGAYQIMGQCVCFAKGAAETLKLNMALILFPVCRRILTKLRSSFLSNFVPFDDNINFHKLLAFAIAAMTSVHVLMHLACDFPRMISCPKEKFMNILGDDFDFKQPTYLDLIKSIPGVTGIIMILLMAFAFTLALNSFRRNVIKLPWPFNHLAGFNSFWYVHHLLVVVYVLLVIHGYFLFLTHDWTKKTTWMYIVVPVFLYATERTYSIFNESNHRVSVLKATIYKGNVLALRMSKPPGFEFKSGMYLFVKCPEISRFEWHPFSITSAPDDDYLSVHIRSLGDWTTALKNRFAACQPERPQSKSGNFIQTEEAAVSDDKQPQAGYPRILIKGPYGAPSQNFDEYDILLLIGLGIGATPFISILKDLLKKIELNDLEGSTGSSGSSKSHGKGPKRAYFYWATGEQGSFEWFKGVMDDIAEHDEHHIIEMHNHLTSVHGEGDARSALISMIQKLQHAKNGVDVVSESRIKTHFGRPNWQKVFSEMASRHESSRIGVFYCGNATLTQKLKKLCQEFSSNSSTRFEFHKENF

Retrieve as FASTA  
Remarks Short 5' end. Not found in upstream sequence
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTCTGGAGCTTCCAAAGGTCTCACGAGTCTTCGTTTTCTTGATACAACCCTCAGTGGGAAGGAAAGTGATACTTGGAAACCGATTGAGGATAGGTTTAATAGGCATGCAGTAGAT
GGGAGACTCTTCAGGGACAATTTTGGTGCTTGCATAG
GTAAAATAATCTTGCTCATTAATCTCTTATATATACATACATATATATATATATATATATATTTAATGGATATATATGTATTA
GTATGTTGTGTATGTGGATTGTGGAATTTGAGAGTCTTGGAAAAATGGTTTTTGTAGGAATGGTAAGGGAGTCAAAGGATTTTGCTGGAGAGCTGTTTGATGCTTTGGCTAGGCATAGAA
AGATAAGTGCAGAAAATGGTATAACTCGAGATGAACTGAGAATGTTTTGGGAGGATATGACTAATGAAGACCTTGAATCAAGATTGCAGATCTTTTTTGACAT
GTGAGGATAACTAACAG
GTCACTCTTTTCTTGTTGTTTTGTTGCTCTTTTCTCGTGCTACAAGTAAATTCTGGGTACTTAAATTTGTTACTAGGTGTGACAAGAATGGAGATGGGAAGCTTTCAGAGGAAGAAGTTA
AGGAG
GTAAGGCCAGAGGCCCACAAGTATGGTTGATCATTTTCTATATTTGTTTAATTCTCTCTCTTTTCTTGTTAGTGTTTTCTGAAATTTTGTGTGTAAAAATTGTAAAGGTTATAGT
TTTGAGTGCCTCGGCGAACAAGTTGGCAAATTTTAAGCAGCAAGCTGCAGCATATGCAGCTCTGATCATGGAAAAGCTAGATCCTGACCATCTTGGTTATATAAAG
GTGAATTGTTGCTG
ATTTTGCCTTTTTCTTTTTCTTTTTTTCCTCATCTTTGTCTTCATCCTTTCTCCAGTTTCTCACTTTAAACTTCTTAATTTTTTCAGATGTGGCAACTAGAAACTCTACTCAAGGGAATG
GTGAACTCCGAAGAGAACGACGACGTTTTAAAGGAAACCAAAAGTCTCACGAAATCCATGATTCCCAGAAAATACCAAACACCTTTTAGCAAGTTCATATCCACAACTAAGGAATTCATC
CATGAAAATTGGAAGAGAATATGGGTTATCACTTTGTGGTTAGCCATCAACTTGGGCCTCTTTCTTTGGAAGTACTTTCAATATAAGAACAGAGGAGCTTACCAAATCATGGGCCAGTGT
GTCTGCTTTGCCAAAGGTGCTGCTGAGACTCTCAAACTCAATATGGCTCTAATTCTCTTCCCAGTTTGTAGGAGAATTCTCACAAAGCTCAGATCATCATTTCTCAGTAACTTTGTCCCT
TTTGATGACAACATCAACTTCCACAAGTTATTGGCATTTGCAATAGCAGCTATGACTTCTGTACATGTTTTAATGCATTTAGCTTGTGATTTTCCGAGAATGATTTCGTGCCCAAAAGAA
AAGTTTATGAACATTTTGGGAGACGATTTCGACTTCAAGCAGCCAACTTACCTGGACTTGATAAAAAGTATTCCAGGTGTGACCGGGATTATAATGATCCTTCTAATGGCTTTTGCCTTC
ACTCTGGCGTTAAACTCATTCAGGAGAAATGTCATCAAGTTGCCATGGCCATTCAACCATTTGGCAGGGTTTAATTCTTTCTGGTATGTACATCATTTGCTGGTTGTGGTGTATGTACTC
CTTGTCATACATGGCTACTTCCTATTTCTCACCCACGACTGGACCAAGAAGACG
GTATGTATGCTAATTTTTTGTATTGAACATGTTCTAGTGAAACCCTACACTGAAAGAAAAGTCTAC
GAGGTATCACTGGTGCTTAGAACAATATTTACTCGAGAAAGATACTAATTTCTTGGCTTTAAGTGATGCTGACATTAAATTGAACTATATTTTTTGTGCAGACATGGATGTATATAGTGG
TCCCTGTCTTTCTTTATGCAACTGAAAGGACTTATTCAATCTTCAATGAAAGCAATCACCGTGTCAGTGTTCTTAAG
GTCAGTAGAAGCAATTTTTTATTTTTCATTAACTAGTTTGGAA
TAGTCGAGAAACTGGAAGCGAAGTCCTTATATTCTTTGAACGTTGCAGGCAACGATATACAAAGGTAATGTGCTAGCATTGCGCATGAGCAAACCTCCAGGATTCGAGTTCAAAAGTGGA
ATGTATCTTTTTGTCAAGTGTCCAGAGATATCCAGATTTGAATG
GTATGAACCATATATTTAACGCATATATGACTTGACTGTAAGTAAAAGTTTTCTTGTCATGATCAAGTTTGGACAC
TGTTATTTGCTTCAGGCATCCTTTTTCCATCACTTCTGCACCCGATGATGACTACTTGAGTGTCCATATAAGGAGCTTAGGGGATTGGACTACGGCACTTAAAAACAGATTTGCACCGGT
ATATAACCTCATTATGCGTAAACCATAGAATAAAGCTCAACTGATAAATCATTTGTTTCCATAGCTTCAGCATACTTGAGTCAAATGATGCAGGCATGTCAACCAGAAAGACCACAATCA
AAGAGTGGAAACTTCATCCAGACGGAAGAAGCAGCTGTCTCAGATGACAAACAGCCCCAAGCAGG
GTGAGCAAAATCTGAGACAAGATTCTTCAGAGCTTTCGCTCTTTGCTATCATATC
AAACACACTCTTCTTTCTGGTGTCAGGTATCCAAGAATCCTCATAAAGGGGCCATATGGAGCTCCATCACAGAATTTCGACGAGTATGACATTCTCTTGCTCATTGGTCTTGGAATTGGG
GCAACTCCATTCATTAGCATTCTTAAAGATCTTTTGAAAAAAATTGAGCTAAATGACCTTGAATCT
GTGAGTTAAGAGGCAAATCAATCAGATCTATCTTCTGTTTGAAATGTGTTAAAC
ATGTGGTATTTACTTGGAAAGAGTGACAAATGCAGGGATCAACTGGCAGCAGTGGTTCATCAAAATCACATGGAAAAGGTCCTAAAAGAGCATACTTTTACTGGGCAACAGGTGAACAAG
GATCCTTTGAATGGTTTAAAGGTGTCATGGATGACATCGCAGAGCACGACGAACAT
GTAGGTTTCGGATCTCACTCAGCTTGACACGTTTAATTCGTATTGAAAGTGTCATAATCAAAAA
AGTTTTTGGAAAGTAATGAAAAGGGATCATATTTGAAGGAGTATGATATTTTTCTTTCTAGTGTTTATTAGAAGTTGTTACTAGAATCAAACATATTCCTTTCTAGCCTGCTTGCTTATT
TTTTTTAACAATATAGGGATAGGAATCAAAATTATGTGCATAAATCATTTTTTTTTTGGTGTGCTTAGTTATATTTTTAACAGTTACTAAGTACATAAGAATATTTTTATAATTCATTTC
AATGGAATCCTCACTTTTCTAATCAAGTAAAACCTACAAAAACTTTGTTCCCAATTGTACTCGTAGTAGTAAAAGTATGAATTAATGGGAAAAGGAAGCATTTTCCCTGTTCTCTTTCCT
CAGCTATTTTCATAACTGAAGTAACTCAATTGGTCATGACATTATGATGTTTTGTGGTCCTTGAATATTTGCAGCATATAATAGAAATGCACAACCATTTGACTAGTGTACATGGAGAAG
GAGATGCAAGGTCTGCTCTTATTTCCATGATTCAAAAGCTGCAACATGCTAAGAATGGGGTTGACGTTGTCTCCGAAAGCCGG
GTATATGTATTCATTAAGTACAAACCGAAATTAATTT
ACTAGTTATTAATTCTGCATTATCATTATTATATTTTATCTTTTTTGACATGTAAATTACAACAGATAAAAACTCATTTTGGAAGACCAAATTGGCAAAAAGTGTTTTCTGAGATGGCGA
GTAGGCATGAATCTTCTCGGATAG
GTATTGAATTATATAACATTACTATAAAGAATATAAAGAAAGATTCTTCTTGTTCTTTTGATTTCTCATTAGTGGTTGATTTTGCTATAACAGGTG
TATTCTACTGTGGAAATGCTACACTCACCCAAAAACTGAAGAAGCTTTGCCAAGAATTCAGCTCAAATTCGTCAACTCGTTTCGAATTTCACAAAGAGAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTCTGGAGCTTCCAAAGGTCTCACGAGTCTTCGTTTTCTTGATACAACCCTCAGTGGGAAGGAAAGTGATACTTGGAAACCGATTGAGGATAGGTTTAATAGGCATGCAGTAGAT
GGGAGACTCTTCAGGGACAATTTTGGTGCTTGCATAG
GAATGGTAAGGGAGTCAAAGGATTTTGCTGGAGAGCTGTTTGATGCTTTGGCTAGGCATAGAAAGATAAGTGCAGAAAATGGT
ATAACTCGAGATGAACTGAGAATGTTTTGGGAGGATATGACTAATGAAGACCTTGAATCAAGATTGCAGATCTTTTTTGACAT
GTGTGACAAGAATGGAGATGGGAAGCTTTCAGAGGAA
GAAGTTAAGGAG
GTTATAGTTTTGAGTGCCTCGGCGAACAAGTTGGCAAATTTTAAGCAGCAAGCTGCAGCATATGCAGCTCTGATCATGGAAAAGCTAGATCCTGACCATCTTGGTTAT
ATAAAG
ATGTGGCAACTAGAAACTCTACTCAAGGGAATGGTGAACTCCGAAGAGAACGACGACGTTTTAAAGGAAACCAAAAGTCTCACGAAATCCATGATTCCCAGAAAATACCAAACA
CCTTTTAGCAAGTTCATATCCACAACTAAGGAATTCATCCATGAAAATTGGAAGAGAATATGGGTTATCACTTTGTGGTTAGCCATCAACTTGGGCCTCTTTCTTTGGAAGTACTTTCAA
TATAAGAACAGAGGAGCTTACCAAATCATGGGCCAGTGTGTCTGCTTTGCCAAAGGTGCTGCTGAGACTCTCAAACTCAATATGGCTCTAATTCTCTTCCCAGTTTGTAGGAGAATTCTC
ACAAAGCTCAGATCATCATTTCTCAGTAACTTTGTCCCTTTTGATGACAACATCAACTTCCACAAGTTATTGGCATTTGCAATAGCAGCTATGACTTCTGTACATGTTTTAATGCATTTA
GCTTGTGATTTTCCGAGAATGATTTCGTGCCCAAAAGAAAAGTTTATGAACATTTTGGGAGACGATTTCGACTTCAAGCAGCCAACTTACCTGGACTTGATAAAAAGTATTCCAGGTGTG
ACCGGGATTATAATGATCCTTCTAATGGCTTTTGCCTTCACTCTGGCGTTAAACTCATTCAGGAGAAATGTCATCAAGTTGCCATGGCCATTCAACCATTTGGCAGGGTTTAATTCTTTC
TGGTATGTACATCATTTGCTGGTTGTGGTGTATGTACTCCTTGTCATACATGGCTACTTCCTATTTCTCACCCACGACTGGACCAAGAAGACG
ACATGGATGTATATAGTGGTCCCTGTC
TTTCTTTATGCAACTGAAAGGACTTATTCAATCTTCAATGAAAGCAATCACCGTGTCAGTGTTCTTAAG
GCAACGATATACAAAGGTAATGTGCTAGCATTGCGCATGAGCAAACCTCCA
GGATTCGAGTTCAAAAGTGGAATGTATCTTTTTGTCAAGTGTCCAGAGATATCCAGATTTGAATG
GCATCCTTTTTCCATCACTTCTGCACCCGATGATGACTACTTGAGTGTCCATATA
AGGAGCTTAGGGGATTGGACTACGGCACTTAAAAACAGATTTGCACCG
GCATGTCAACCAGAAAGACCACAATCAAAGAGTGGAAACTTCATCCAGACGGAAGAAGCAGCTGTCTCAGAT
GACAAACAGCCCCAAGCAGG
GTATCCAAGAATCCTCATAAAGGGGCCATATGGAGCTCCATCACAGAATTTCGACGAGTATGACATTCTCTTGCTCATTGGTCTTGGAATTGGGGCAACT
CCATTCATTAGCATTCTTAAAGATCTTTTGAAAAAAATTGAGCTAAATGACCTTGAATCT
GGATCAACTGGCAGCAGTGGTTCATCAAAATCACATGGAAAAGGTCCTAAAAGAGCATAC
TTTTACTGGGCAACAGGTGAACAAGGATCCTTTGAATGGTTTAAAGGTGTCATGGATGACATCGCAGAGCACGACGAACAT
CATATAATAGAAATGCACAACCATTTGACTAGTGTACAT
GGAGAAGGAGATGCAAGGTCTGCTCTTATTTCCATGATTCAAAAGCTGCAACATGCTAAGAATGGGGTTGACGTTGTCTCCGAAAGCCGG
ATAAAAACTCATTTTGGAAGACCAAATTGG
CAAAAAGTGTTTTCTGAGATGGCGAGTAGGCATGAATCTTCTCGGATAG
GTGTATTCTACTGTGGAAATGCTACACTCACCCAAAAACTGAAGAAGCTTTGCCAAGAATTCAGCTCAAAT
TCGTCAACTCGTTTCGAATTTCACAAAGAGAACTTTTAG

Retrieve as FASTA