Entry information : ToriRboh10(PON84171.1/TorRBOH6)
Entry ID 16258
Creation 2020-03-20 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-10 (Christophe Dunand)
Peroxidase information: ToriRboh10(PON84171.1/TorRBOH6)
Name ToriRboh10(PON84171.1/TorRBOH6)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh002]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Trema orientalis    [TaxId: 63057 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ToriRboh10
start..stop
S start..stop
PandeRboh09 1488 0 5..776 1..772
ToriRboh09 1249 0 1..776 65..839
PandeRboh07 1244 0 1..776 65..839
JregRboh08 1203 0 3..776 31..803
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 442030..442198 169 N° 2 441730..441895 166 N° 3 441588..441636 49 N° 4 441366..441479 114
N° 5 440463..441269 807 N° 6 440199..440294 96 N° 7 439994..440109 116 N° 8 439805..439907 103
N° 9 439643..439734 92 N° 10 439402..439561 160 N° 11 439172..439312 141 N° 12 438549..438677 129
N° 13 438367..438445 79 N° 14 438166..438275 110  
complement(join(438166..438275,438367..438445,438549..438677,439172..439312,4394 02..439561,439643..439734,439805..439907,439994..440109,440199..440294,440463..4 41269,441366..441479,441588..441636,441730..441895,442030..442198))


exon

Literature and cross-references ToriRboh10(PON84171.1/TorRBOH6)
Protein sequence: ToriRboh10(PON84171.1/TorRBOH6)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   776
PWM (Da):   %s   88463.08  
PI (pH):   %s   8.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTGKMSSGASKGLTSLRFLDTTLSGKESDTWKPIEERFSKHAVDGRLCRDNFGACIGMVRESKDFAGELFDALARHRKISAENGITRDELRMFWEDMTNEDLESRLQIFFDMCDKNGDGKLSEEEVKVIVLSASANKLANFKQQAAAYAALIMEKLDPDHLGYIKMWQLETLLKGMVNSEENDDVLKETKSLTKSMIPRRYQTPLSKFISTTKEFIHENWKRIWVITFWLAINLGLFLWKYFQYKNRGAYQIMGQCVCFAKGAAETLKLNMALILFPVCRRILTKLRSSFLSNFVPFDDNINFHKLFAFAIAAMTSVHVLMHLACDFPRMISCPKEKFMNILGDDFDFKQPTYLDLIKSIPGVTGIIMILLMAFAFTLALNSLRRNVIKLPWPFNHLAGFNSFWYVHHLLVVVYVLLVIHGYFLFLTHDWTKKTTWMYIVVPVFLYATERTYSIFNESNHRVSVLKATIYKGNVLALRMSKPQGFEFKSGMYLFVKCPDISRFEWHPFSITSAPDDDYLSVHIRSLGDWTTALKNRFAACRPERTQSKSGNLIQTEKAAVSDDKQPQAGYPRILIKGPYGAPSQNFDEYDILLLIGLGIGATPFISILKDLLKKIELNDLEGSTGSSGSSKSHGKGPKRAYFYWATGEQGSFEWFKGVMDDIAEHDEHHIIEMHNHLTSVHGEGDARSALISMIQKLQHAKNGVDVVSESRIKTHFGRPNWQKVFSEMASRHESSRIGVFYCGNATLTQKLRKLCQEFSSNSSTRFEFHKENF

Retrieve as FASTA  
Remarks Short 5' end. Not found in upstream sequence
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGGAAAAATGAGTTCTGGAGCTTCCAAAGGTCTCACGAGTCTTCGTTTTCTTGATACAACCCTCAGTGGGAAGGAAAGTGATACTTGGAAACCGATTGAGGAGAGGTTTAGTAAG
CATGCAGTAGATGGGAGACTCTGTAGGGACAATTTTGGTGCCTGCATAG
GTAAAAAAATCTTGCTCATTAATCTCTTATATATATATACATACATATATTTTTTTATATGGATATGTGCA
TGTGTTAGTATGTTGTGTATGTGGATTGTGGAATTTGAGTCTTGGAAAAATGGGTTTATGTAGGAATGGTAAGGGAGTCAAAGGATTTTGCTGGAGAGCTGTTTGATGCTTTGGCTAGGC
ATAGAAAGATAAGTGCAGAAAACGGTATAACTCGAGATGAACTGAGAATGTTTTGGGAGGATATGACTAATGAAGACCTTGAATCAAGATTGCAGATCTTTTTTGACAT
GTGAGGATAAC
TAACAAGTCACACTTTTCTTGTTGTTTTGTTGCTTTTTTCTTGTGCTACAAATAAACTATGGGTACCTCAATTTGTTACTAGGTGTGACAAGAATGGAGATGGGAAGCTTTCAGAGGAAG
AAGTTAAGGAG
GTAAGGCCAGAGGCCCACAAGTATGGTTAATCATTTTCTCTATTTGTTTAATTCTCTCTCTTTTCCTGTTAGTGTCTTCTGAAATTGTGTGTGTAAAAATTGTAAAAGG
TTATAGTTTTGAGTGCCTCGGCGAACAAGTTGGCAAATTTCAAACAGCAAGCTGCAGCATATGCAGCTCTGATCATGGAAAAGCTAGATCCTGACCATCTTGGTTATATAAAG
GTGAATT
GTTGCTGATTTTGCCTTTTTCTATTTTCCTTATCTTTGTCTTCACCTTTTCTCCAGTTTCTCACTTTAAACTTTTCTAATTTTTCTCAGATGTGGCAACTTGAAACTCTACTCAAGGGAA
TGGTGAACTCCGAAGAGAATGACGACGTTTTAAAGGAAACCAAAAGTCTCACTAAATCCATGATTCCCAGAAGATACCAAACACCTTTGAGCAAGTTCATATCCACAACTAAGGAATTCA
TCCATGAAAATTGGAAGAGAATATGGGTTATCACTTTTTGGTTAGCCATCAACTTGGGCCTCTTTCTTTGGAAGTACTTTCAATATAAGAACAGAGGAGCTTACCAAATCATGGGCCAGT
GTGTCTGCTTTGCCAAAGGTGCTGCTGAGACTCTCAAGCTCAATATGGCTCTCATTCTCTTCCCAGTATGTAGGAGAATTCTCACAAAGCTCAGATCATCATTTCTCAGTAACTTTGTCC
CTTTTGATGACAACATCAACTTCCACAAGTTATTTGCATTTGCAATAGCAGCTATGACTTCTGTACATGTTTTGATGCATTTAGCTTGTGATTTTCCGAGAATGATTTCGTGCCCGAAAG
AGAAGTTTATGAACATTTTGGGAGACGATTTCGACTTCAAGCAGCCAACTTACCTGGACTTGATAAAAAGTATTCCAGGTGTGACCGGGATTATAATGATCCTTCTAATGGCTTTTGCCT
TCACTCTGGCGTTAAACTCACTCAGGAGAAATGTCATCAAGTTGCCATGGCCATTCAACCATTTGGCAGGGTTTAATTCTTTCTGGTATGTACATCATTTGCTGGTTGTGGTGTATGTAC
TCCTTGTCATACATGGCTACTTCCTATTTCTCACCCACGACTGGACCAAGAAGACG
GTATGTATGCTATTTTTTTGTATTGAACATGTTCTAGTGAAACCCTACACTCAAAGAAAAGTCT
ACGATGTATCACTGTTGCTTAGAACAATATTTACCAGAGAAAGATACTAATTTCTTGGCTTAAAATGATGCTGACATTAAATTGAACTATATTTTTTTGTGTAGACATGGATGTATATAG
TGGTCCCTGTCTTTCTCTATGCAACTGAAAGGACTTATTCAATCTTCAACGAAAGCAATCACCGTGTCAGTGTTCTTAAG
GTCAGTAGAAGCAGTGTTTTTTTTCAGTAAATAGTTTGGA
ATAGTCGAGAAACTTGAAGCGAAGTCATTATATTCTTTGAACGTTGCAGGCAACGATATACAAAGGTAATGTGCTAGCATTGCGCATGAGCAAACCTCAAGGATTCGAGTTCAAAAGTGG
AATGTATCTTTTTGTCAAGTGTCCAGATATATCTAGATTTGAATG
GTATGAACCATATATTTAATGCATATGTGACTTTACGTAAAATTTATCTTGCCATGATCAAGTTTGGACACTGTT
ATTTGCTTCAGGCATCCTTTTTCCATCACTTCTGCACCAGATGATGACTACTTGAGTGTCCATATAAGGAGCTTAGGGGATTGGACCACAGCACTTAAAAACAGATTTGCACCGGTATAT
AACTTCATTATGCGTAAAATCATTTGTTTCCATAGCTTCAGCGTCCTTAAGTCGAAGAATGCAGGCATGTCGACCAGAAAGAACACAATCAAAGAGTGGAAACCTCATCCAGACGGAAAA
AGCAGCTGTCTCAGATGACAAACAGCCCCAAGCAGG
GTGAGCAGAATCTGAGACAAGATTCTTCAGAGCTTTCACTCTTTGCTATCATATCAAACACTCTCCTCCTTCTGGTGTCAGGTA
TCCAAGAATCCTCATAAAGGGGCCATATGGAGCTCCATCACAGAATTTCGACGAGTATGACATTCTCTTGCTCATTGGTCTTGGAATTGGGGCAACTCCATTCATTAGCATTCTTAAAGA
TCTTTTGAAAAAAATTGAGCTAAATGACCTTGAATCT
GTGAGTTAAGAGGCAAATCAATCAGATCTATCTTCTGTTTGAAATGTGTTAAACATGTGGTATTTACTTGGAAAGAGTGACAA
ATGCAGGGATCAACTGGCAGTAGTGGTTCATCCAAATCACATGGAAAAGGTCCTAAAAGAGCTTACTTTTACTGGGCAACAGGTGAACAAGGATCCTTCGAATGGTTTAAAGGTGTCATG
GATGACATCGCAGAGCACGACGAACAT
GTAGGTTTCGGATCTCAACTTGACACGTTTACTAATTTCTTAATGAATATTTCATAATAAAAAAAGTTCTTGGAAAGTAATGAAAAGGGATCA
TATTTGAAGGAATATGATATTTTTCTTTCTAGTGTTTATTAGAAGTTGTTGCTGGAATCAGAGATATTCCTTTCTAGCTGGCTTGCTTATTTTTTTTTAGCAATATAGGGATAGGAATCA
AAATTATGCGCATAAATCTTTTTTTGTCTGCTTAGATATATTTTTAACAGTTATTAAGTACATAAGAATAATTTTATAATTCATTTCAATGGAATCCTCACTTTTCTAATCAAGTAAAAC
CTACAAAAACTTTGTTCCCAATTGTAGTTGTAATAGTAAACGTATGAATTAATGGGAAAAGGAAGCTTTTTCCCTGTTCTCTTTCCTCAGCTATTTTCATAACTGAAGTAACTCAATTGG
TCATGACATTATGATGTTTTGGGGTCCCTGAATATTTGCAGCATATAATAGAAATGCACAACCACTTGACTAGTGTACATGGAGAAGGAGATGCAAGGTCTGCTCTTATTTCCATGATTC
AAAAGCTGCAACATGCTAAGAATGGGGTTGATGTTGTCTCAGAAAGCCGG
GTATATGTATATCATTAAGTACAAACCAATATTAATTTACTCGTTATGAATTATGCATTATCATTATTAT
ATCTTATCTTTTTTGACATGTAAATTACAACAGATAAAAACTCATTTTGGAAGACCAAATTGGCAAAAAGTGTTTTCTGAGATGGCAAGTAGGCATGAATCTTCTCGGATAGGTATTGAA
TTATAAAATTACTATAAAGAACATAAAGAAAGATTCTTCTTGTTCTTTTGATTTCTCATTAGTGGTTGATTTTGCTATAACAGGTGTATTCTACTGTGGAAATGCTACACTCACCCAAAA
ACTGAGGAAGCTTTGCCAAGAATTCAGCTCAAATTCATCAACCCGTTTCGAATTTCACAAAGAGAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGGAAAAATGAGTTCTGGAGCTTCCAAAGGTCTCACGAGTCTTCGTTTTCTTGATACAACCCTCAGTGGGAAGGAAAGTGATACTTGGAAACCGATTGAGGAGAGGTTTAGTAAG
CATGCAGTAGATGGGAGACTCTGTAGGGACAATTTTGGTGCCTGCATAG
GAATGGTAAGGGAGTCAAAGGATTTTGCTGGAGAGCTGTTTGATGCTTTGGCTAGGCATAGAAAGATAAGT
GCAGAAAACGGTATAACTCGAGATGAACTGAGAATGTTTTGGGAGGATATGACTAATGAAGACCTTGAATCAAGATTGCAGATCTTTTTTGACAT
GTGTGACAAGAATGGAGATGGGAAG
CTTTCAGAGGAAGAAGTTAAGGAG
GTTATAGTTTTGAGTGCCTCGGCGAACAAGTTGGCAAATTTCAAACAGCAAGCTGCAGCATATGCAGCTCTGATCATGGAAAAGCTAGATCCTGAC
CATCTTGGTTATATAAAG
ATGTGGCAACTTGAAACTCTACTCAAGGGAATGGTGAACTCCGAAGAGAATGACGACGTTTTAAAGGAAACCAAAAGTCTCACTAAATCCATGATTCCCAGA
AGATACCAAACACCTTTGAGCAAGTTCATATCCACAACTAAGGAATTCATCCATGAAAATTGGAAGAGAATATGGGTTATCACTTTTTGGTTAGCCATCAACTTGGGCCTCTTTCTTTGG
AAGTACTTTCAATATAAGAACAGAGGAGCTTACCAAATCATGGGCCAGTGTGTCTGCTTTGCCAAAGGTGCTGCTGAGACTCTCAAGCTCAATATGGCTCTCATTCTCTTCCCAGTATGT
AGGAGAATTCTCACAAAGCTCAGATCATCATTTCTCAGTAACTTTGTCCCTTTTGATGACAACATCAACTTCCACAAGTTATTTGCATTTGCAATAGCAGCTATGACTTCTGTACATGTT
TTGATGCATTTAGCTTGTGATTTTCCGAGAATGATTTCGTGCCCGAAAGAGAAGTTTATGAACATTTTGGGAGACGATTTCGACTTCAAGCAGCCAACTTACCTGGACTTGATAAAAAGT
ATTCCAGGTGTGACCGGGATTATAATGATCCTTCTAATGGCTTTTGCCTTCACTCTGGCGTTAAACTCACTCAGGAGAAATGTCATCAAGTTGCCATGGCCATTCAACCATTTGGCAGGG
TTTAATTCTTTCTGGTATGTACATCATTTGCTGGTTGTGGTGTATGTACTCCTTGTCATACATGGCTACTTCCTATTTCTCACCCACGACTGGACCAAGAAGACG
ACATGGATGTATATA
GTGGTCCCTGTCTTTCTCTATGCAACTGAAAGGACTTATTCAATCTTCAACGAAAGCAATCACCGTGTCAGTGTTCTTAAG
GCAACGATATACAAAGGTAATGTGCTAGCATTGCGCATG
AGCAAACCTCAAGGATTCGAGTTCAAAAGTGGAATGTATCTTTTTGTCAAGTGTCCAGATATATCTAGATTTGAATG
GCATCCTTTTTCCATCACTTCTGCACCAGATGATGACTACTTG
AGTGTCCATATAAGGAGCTTAGGGGATTGGACCACAGCACTTAAAAACAGATTTGCACCG
GCATGTCGACCAGAAAGAACACAATCAAAGAGTGGAAACCTCATCCAGACGGAAAAAGCA
GCTGTCTCAGATGACAAACAGCCCCAAGCAGG
GTATCCAAGAATCCTCATAAAGGGGCCATATGGAGCTCCATCACAGAATTTCGACGAGTATGACATTCTCTTGCTCATTGGTCTTGGA
ATTGGGGCAACTCCATTCATTAGCATTCTTAAAGATCTTTTGAAAAAAATTGAGCTAAATGACCTTGAATCT
GGATCAACTGGCAGTAGTGGTTCATCCAAATCACATGGAAAAGGTCCT
AAAAGAGCTTACTTTTACTGGGCAACAGGTGAACAAGGATCCTTCGAATGGTTTAAAGGTGTCATGGATGACATCGCAGAGCACGACGAACAT
CATATAATAGAAATGCACAACCACTTG
ACTAGTGTACATGGAGAAGGAGATGCAAGGTCTGCTCTTATTTCCATGATTCAAAAGCTGCAACATGCTAAGAATGGGGTTGATGTTGTCTCAGAAAGCCGG
ATAAAAACTCATTTTGGA
AGACCAAATTGGCAAAAAGTGTTTTCTGAGATGGCAAGTAGGCATGAATCTTCTCGGATAG
GTGTATTCTACTGTGGAAATGCTACACTCACCCAAAAACTGAGGAAGCTTTGCCAAGAA
TTCAGCTCAAATTCATCAACCCGTTTCGAATTTCACAAAGAGAACTTTTAG

Retrieve as FASTA