Entry information : ToriRboh12(PON84170.1 / TorRBOH7)
Entry ID 16260
Creation 2020-03-20 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-10 (Christophe Dunand)
Peroxidase information: ToriRboh12(PON84170.1 / TorRBOH7)
Name ToriRboh12(PON84170.1 / TorRBOH7)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh002]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Trema orientalis    [TaxId: 63057 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ToriRboh12
start..stop
S start..stop
PandeRboh10 1463 0 1..767 1..767
ToriRboh10 1190 0 12..767 1..776
PandeRboh09 1180 0 16..767 1..772
ToriRboh09 1155 0 12..767 65..839
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 431385..431592 208 N° 2 431108..431273 166 N° 3 430958..431006 49 N° 4 430739..430852 114
N° 5 429881..430651 771 N° 6 429489..429584 96 N° 7 429286..429401 116 N° 8 429109..429208 100
N° 9 428934..429004 71 N° 10 428695..428851 157 N° 11 428460..428600 141 N° 12 427618..427746 129
N° 13 427442..427520 79 N° 14 427218..427324 107  
complement(join(427218..427324,427442..427520,427618..427746,428460..428600,4286 95..428851,428934..429004,429109..429208,429286..429401,429489..429584,429881..4 30651,430739..430852,430958..431006,431108..431273,431385..431592))


exon

Literature and cross-references ToriRboh12(PON84170.1 / TorRBOH7)
Protein sequence: ToriRboh12(PON84170.1 / TorRBOH7)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   767
PWM (Da):   %s   87122.19  
PI (pH):   %s   8.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFQKNSSTTTSMTGEMSSGASKGLMSLHFLDTKLAPNGKESDTWESIEESFNKNAVDERLSRDKFGLCIGMGGESKDFAGELFDALARRRKISAENGVTRDELEMFWKDMTNQDPELRLQIFFDMCDKNGDGKLSKEEVEVIILSASANKLTNLKQQAASYADLIMQKLDPDHLGYIQLWQLQTLLRGMVNSEATAMTPKRNKTPLSKLLSKTRKLIHDNWKRIWVITLWLTLNLGLFLWKFYQYKNRGAYQIMGQCLCFAKGAAETLKFNMALILFPVCRRTLTRLRSSFLNNIFPFDDNINFHQLIALAIATMTSVHVLMHLACDFPRMISSPKEKFMNILGHDFDFKQPTYPELLSSIPGVTGILMILLMAFAFTLALNSFRKSIVKLPWPFHHLAGFNSFWYVHHLLALVYVLLVIHGYFLFLTHGWSKKTTWMYIIVPILFYATERTYSTINESGYSVHVENAMICKGKVLALYLSKPRGFEYKSGMYLFVKCPDISKFEWHPFSITSAPGDDYLSVHIKSLGDWTTELRSRFASQRENTQETETKAVSGTKPPQAGNPRILIKGPYGAPSQDFDEYDILLLIGLGIGATPFISILKDILNIEQSDLEGSTASSGSSESNRKGPKRAYFYWATGEQGSFEWFKGVMDDIAEHDQHHIIEMHNHLTSVHGEGDARSALISMIQQLQHDENGVDVVSESRIKTHFGRPDWRKVFSEMARKHESSRIGVFYCGPPTLTKKLKKLCQEFSSNSTSFDFHKENF

Retrieve as FASTA  
Remarks 11 AA added in 5'
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCAAAAGAACAGTAGTACTACGACCTCCATGACTGGAGAAATGAGTTCTGGAGCTTCCAAAGGGCTCATGAGTCTTCATTTTCTTGATACAAAGTTAGCCCCTAATGGGAAGGAA
AGTGATACCTGGGAATCGATTGAGGAGAGCTTTAATAAGAACGCAGTTGATGAGAGACTCTCCAGGGACAAATTTGGACTCTGCATAG
GTAAAAAATCTCTTTCCCATTAATCACTTTAG
TATGTGTGTGTATTTGTTCTGGTATATTATGTATGTGGGTTGTGGAGTTTGAGAGTTATGGAGAAATGGGCTTTTGTAGGAATGGGAGGGGAATCAAAGGATTTTGCAGGAGAGCTGTTT
GATGCTCTGGCTAGGCGTAGAAAGATATCTGCAGAAAATGGTGTGACTCGAGATGAACTGGAAATGTTTTGGAAGGATATGACTAATCAAGACCCTGAATTAAGATTGCAAATCTTTTTT
GACAT
GTGAGGATAAACTAGTTTCTTTTATCTTTTCTTCTTGTTTTGTTGCTTTTTTCTTCCTTGTGCTCCAAGTAAACTATGGTACTTTAAAAAAAAATTATCAGGTGTGACAAGAATG
GAGATGGTAAACTTTCAAAGGAAGAGGTTGAAAAG
GTAGGGACAGAGAACCCCAAGTATTGTTGATGATTTTCTCTTCTTGTTTAACTCTCTCCTCTTTGAAGTCCTTTCTGAAATTTAT
TTGTGTGACAAATATTAAAGGTTATAATTTTGAGTGCCTCGGCGAACAAGTTGACGAATCTTAAACAGCAAGCGGCATCATATGCAGATCTGATTATGCAAAAGCTAGATCCTGACCATC
TTGGTTATATACAG
GTGAAATGTTTGCTATGCTTTCCCTCCTCCCTTTATCTTTAGCTTCATCTTCACCTTTCTTATATATATATATATATATATTCACAGTTATGGCAGCTACAAACTC
TACTCAGGGGAATGGTGAACTCCGAAGCGACAGCCATGACACCCAAAAGAAACAAAACGCCCTTAAGCAAGCTCCTTTCCAAAACAAGGAAGCTCATCCATGACAACTGGAAGAGAATTT
GGGTCATCACCTTGTGGTTAACCCTCAATTTGGGCCTATTTCTTTGGAAGTTCTATCAATATAAGAACAGAGGAGCTTACCAAATCATGGGTCAATGTCTCTGCTTTGCCAAAGGTGCTG
CTGAGACTCTCAAGTTCAATATGGCTCTCATTCTCTTCCCAGTATGTAGGAGAACTCTCACAAGACTCAGATCATCATTTCTCAATAATATATTCCCTTTTGATGACAACATCAATTTCC
ATCAGTTGATTGCACTTGCAATAGCAACTATGACTTCTGTACACGTTTTGATGCATTTAGCTTGTGACTTTCCGCGGATGATTTCAAGCCCGAAAGAAAAGTTCATGAACATTTTGGGGC
ACGATTTCGACTTCAAGCAGCCAACTTATCCCGAATTGCTTTCAAGTATTCCAGGCGTAACCGGGATTTTAATGATCCTTCTAATGGCTTTTGCCTTCACTCTGGCATTAAACTCATTTA
GAAAAAGTATTGTCAAGTTGCCATGGCCATTCCATCATTTGGCAGGGTTCAATTCTTTCTGGTATGTACATCATTTGCTGGCTTTGGTGTATGTACTCCTTGTCATACATGGCTACTTCC
TATTTCTCACCCATGGCTGGAGCAAAAAGACG
GTATGTATAACATTTTTTGTGATTGAACATGTATAGTGAAATTGTTAACTGTGAAAGAAAACAACTAAGGGGCACCCCTGGTGCTTCT
CACATCAATTTTATTGAAGTGAAGTCCCCACTAATATATTTACACGTGGGACTCACGTCTTTGTTAGTGTATGGTGTTCCAGTATCATTGCTATCCATTGGTAATTTTCATTGTGAACAG
ACTCTAATGCAGAACATACCTGAAAAGATGACTAATTGTCCTGGCTTATAGTTATGCTGAACTAAATTGAAGATATCTTTCTGCGCAGACATGGATGTATATCATAGTCCCAATCTTATT
CTATGCAACTGAAAGGACTTATTCAACCATCAATGAAAGCGGTTACAGTGTCCATGTTGAAAAT
GTCAGTAGAAGCAGCTTTTTCAGTATTTAATTTTGAAAAAGTCCTGAGAAATTGAA
TCAAACTCATCATAATCCTTGCACCTTGCAGGCTATGATATGCAAAGGTAAAGTGCTAGCATTGTACTTGAGCAAACCTCGAGGATTCGAGTACAAAAGTGGAATGTACCTATTTGTCAA
GTGTCCGGATATCTCTAAATTTGAATG
GTAATATTATGAATTTGACTAAAAAGTCTATCTTGCCATGATCAAATTTGGAAACTCAGAGGTGTTATTTGCTTCAGGCATCCCTTCTCCATC
ACTTCTGCACCGGGAGACGACTACTTGAGTGTCCACATAAAGAGCTTAGGGGATTGGACAACAGAACTTAGAAGCAGATTTGAG
GTGATATACTTATTAACTCTATTAATCCTAAACCAT
ATAGAATAAAGCTCAAGTGGAAAATCATTGTTTCCATAACTTCAGCATACTAAGTCAAAGAAATGCAGGCATCTCAGCGTGAAAATACACAAGAGACGGAAACCAAAGCCGTTTCAGGAA
CCAAACCTCCCCAAGCAGG
GTGAGCAGAACCGTAGACAAGATTCTTCATAGCCTTACACTCTTTGCTATCATATCAAACACTCTCCTCATTCTGATGTCAGGAATCCAAGAATCCTTATC
AAGGGACCATATGGAGCTCCGTCTCAGGATTTCGACGAGTATGACATTCTCTTGCTCATCGGTCTTGGAATCGGGGCAACTCCATTCATCAGCATTCTTAAAGACATTTTAAACATCGAG
CAAAGTGACCTTGAATCT
GTGAGTGAAAAGACAAATCAATCAGGATCACATATCTTTTGTCAGAAATGAGTTAGTACATATGGTATTTACATGAAAAAGGGAACCAATGCAGGGATCAAC
GGCCAGTAGTGGCTCATCAGAATCAAACAGGAAAGGTCCTAAAAGAGCCTACTTCTATTGGGCAACAGGTGAACAAGGATCCTTTGAATGGTTCAAAGGTGTCATGGATGACATTGCAGA
GCACGACCAACAT
GTAAGTTTCAGAACTCAAAACACTCTAGACATGTTTACTAATTCGTAATGAAAGCATCGTAACCGAAAATTTTTAGGAAAGTAATATGGAAAGGAGTAATATGATAA
TTTCCCTTCTTTTGTTCATTACCTATTAGAATTGAGTTTGAATCAACATAATAATTACCTTTCTAGTATTTAGATATCTTATAGCAATTTAGGAATACGAATATTCAAAGTAACTTAAGT
ACTAAATTTTATTTGTGCACAAATCATTTTCAGTAGTGACGGAATAATTTTATATTCAAAAGTTCAGGCTTGTCATGATCTCTTCTGGTACATTGCTCCTTTATAATTTTGCCTTCTCAA
AATTAGTTACTCTTTTTCCTTTCTAGATTTTTTCCAGCTGGGTTTTGTCTATCTAGATTTTTTTAGGCCTATGATGAAGTGGTCTTATCGAAAGGAAGGATTTAGGCACAAACTGACACG
GACAAAGTATTTAAATTTCACTGACAGAGTATTTAAATTTTCTTTCTTCTCTAATCAAGTAGAACGCGCAAATTTCTTTCGTAATATGTAAGTAGACATATCACACATTAATGAATAGAA
TAAAAAAAAAAGTATTTTTTGGAATTAGTAAACGTGACATGTTATTCTTATCTCAGCCATTCATATGTAATTAAACTAACTTGGTGATATTTGTTTTTTGGGACCCTTCATGAATATTAA
TTACAGCATATAATAGAAATGCACAACCACTTGACTAGTGTACATGGAGAAGGAGATGCAAGGTCTGCTCTCATTTCCATGATTCAACAGCTGCAACATGATGAGAATGGGGTTGATGTT
GTCTCAGAAAGCCGG
GTATATACATTCATTCATATAGTACAAACCAATATTAATTAAGTCACTAATCATTCATTATCACTAATTATCTTTTTTGACGTGTAAATTACAACAGATAAAGAC
ACATTTTGGAAGACCTGATTGGCGAAAAGTATTTTCTGAGATGGCTAGAAAGCATGAATCTTCTCGAATAG
GTACATAGTGATTAATTATGAGTGTCTGTATACAGAGAACATTATTAAT
TAACATATAAGAAAAAAAAATTCTTGTTCTTCGTTTCTGATTACTTCTTGATTTTGATATTACTGTAGGTGTATTCTACTGTGGACCTCCTACACTCACCAAAAAACTGAAGAAGCTTTG
CCAAGAATTTAGCTCAAATTCAACTAGCTTCGACTTTCACAAGGAGAACTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCAAAAGAACAGTAGTACTACGACCTCCATGACTGGAGAAATGAGTTCTGGAGCTTCCAAAGGGCTCATGAGTCTTCATTTTCTTGATACAAAGTTAGCCCCTAATGGGAAGGAA
AGTGATACCTGGGAATCGATTGAGGAGAGCTTTAATAAGAACGCAGTTGATGAGAGACTCTCCAGGGACAAATTTGGACTCTGCATAG
GAATGGGAGGGGAATCAAAGGATTTTGCAGGA
GAGCTGTTTGATGCTCTGGCTAGGCGTAGAAAGATATCTGCAGAAAATGGTGTGACTCGAGATGAACTGGAAATGTTTTGGAAGGATATGACTAATCAAGACCCTGAATTAAGATTGCAA
ATCTTTTTTGACAT
GTGTGACAAGAATGGAGATGGTAAACTTTCAAAGGAAGAGGTTGAAAAGGTTATAATTTTGAGTGCCTCGGCGAACAAGTTGACGAATCTTAAACAGCAAGCGGCA
TCATATGCAGATCTGATTATGCAAAAGCTAGATCCTGACCATCTTGGTTATATACAG
TTATGGCAGCTACAAACTCTACTCAGGGGAATGGTGAACTCCGAAGCGACAGCCATGACACCC
AAAAGAAACAAAACGCCCTTAAGCAAGCTCCTTTCCAAAACAAGGAAGCTCATCCATGACAACTGGAAGAGAATTTGGGTCATCACCTTGTGGTTAACCCTCAATTTGGGCCTATTTCTT
TGGAAGTTCTATCAATATAAGAACAGAGGAGCTTACCAAATCATGGGTCAATGTCTCTGCTTTGCCAAAGGTGCTGCTGAGACTCTCAAGTTCAATATGGCTCTCATTCTCTTCCCAGTA
TGTAGGAGAACTCTCACAAGACTCAGATCATCATTTCTCAATAATATATTCCCTTTTGATGACAACATCAATTTCCATCAGTTGATTGCACTTGCAATAGCAACTATGACTTCTGTACAC
GTTTTGATGCATTTAGCTTGTGACTTTCCGCGGATGATTTCAAGCCCGAAAGAAAAGTTCATGAACATTTTGGGGCACGATTTCGACTTCAAGCAGCCAACTTATCCCGAATTGCTTTCA
AGTATTCCAGGCGTAACCGGGATTTTAATGATCCTTCTAATGGCTTTTGCCTTCACTCTGGCATTAAACTCATTTAGAAAAAGTATTGTCAAGTTGCCATGGCCATTCCATCATTTGGCA
GGGTTCAATTCTTTCTGGTATGTACATCATTTGCTGGCTTTGGTGTATGTACTCCTTGTCATACATGGCTACTTCCTATTTCTCACCCATGGCTGGAGCAAAAAGACG
ACATGGATGTAT
ATCATAGTCCCAATCTTATTCTATGCAACTGAAAGGACTTATTCAACCATCAATGAAAGCGGTTACAGTGTCCATGTTGAAAAT
GCTATGATATGCAAAGGTAAAGTGCTAGCATTGTAC
TTGAGCAAACCTCGAGGATTCGAGTACAAAAGTGGAATGTACCTATTTGTCAAGTGTCCGGATATCTCTAAATTTGAATG
GCATCCCTTCTCCATCACTTCTGCACCGGGAGACGACTAC
TTGAGTGTCCACATAAAGAGCTTAGGGGATTGGACAACAGAACTTAGAAGCAGATTTGAG
GCATCTCAGCGTGAAAATACACAAGAGACGGAAACCAAAGCCGTTTCAGGAACCAAACCT
CCCCAAGCAGG
GAATCCAAGAATCCTTATCAAGGGACCATATGGAGCTCCGTCTCAGGATTTCGACGAGTATGACATTCTCTTGCTCATCGGTCTTGGAATCGGGGCAACTCCATTCATC
AGCATTCTTAAAGACATTTTAAACATCGAGCAAAGTGACCTTGAATCT
GGATCAACGGCCAGTAGTGGCTCATCAGAATCAAACAGGAAAGGTCCTAAAAGAGCCTACTTCTATTGGGCA
ACAGGTGAACAAGGATCCTTTGAATGGTTCAAAGGTGTCATGGATGACATTGCAGAGCACGACCAACAT
CATATAATAGAAATGCACAACCACTTGACTAGTGTACATGGAGAAGGAGAT
GCAAGGTCTGCTCTCATTTCCATGATTCAACAGCTGCAACATGATGAGAATGGGGTTGATGTTGTCTCAGAAAGCCGG
ATAAAGACACATTTTGGAAGACCTGATTGGCGAAAAGTATTT
TCTGAGATGGCTAGAAAGCATGAATCTTCTCGAATAG
GTGTATTCTACTGTGGACCTCCTACACTCACCAAAAAACTGAAGAAGCTTTGCCAAGAATTTAGCTCAAATTCAACTAGCTTC
GACTTTCACAAGGAGAACTTTTAA

Retrieve as FASTA