Entry information : AdurRboh03(aradu.Aradu.FB2F2.1)
Entry ID 16303
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-23 (Christophe Dunand)
Peroxidase information: AdurRboh03(aradu.Aradu.FB2F2.1)
Name AdurRboh03(aradu.Aradu.FB2F2.1)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Arachis duranensis    [TaxId: 130453 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdurRboh03
start..stop
S start..stop
AipaRboh05 1829 0 1..882 1..882
NschRboh03 1689 0 10..882 13..897
CcajRboh03 1678 0 1..882 1..884
CausRboh03 1672 0 1..882 1..895
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 128..623 496 N° 2 738..897 160 N° 3 2542..2590 49 N° 4 2686..3228 543
N° 5 3575..3961 387 N° 6 4043..4138 96 N° 7 4220..4335 116 N° 8 4420..5111 692
N° 9 5677..5786 110  
join(128..623,738..897,2542..2590,2686..3228,3575..3961,4043..4138,4220..4335,44 20..5111,5677..5786)


exon

Literature and cross-references AdurRboh03(aradu.Aradu.FB2F2.1)
Cluster/Prediction ref. Genebank:   107492136
Protein sequence: AdurRboh03(aradu.Aradu.FB2F2.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   882
PWM (Da):   %s   100161.64  
PI (pH):   %s   9.56
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIQQEEHESWSETESTGSRSTRVGFSGPLSGPLVSNNRKKLSARFKDDDDDLVEITLDVRDDTVSVQNIRGGDPETALLASRLEKRPSSLGVRLRQVSQELKRMTSSQKFDKVDRSKSGAARALKGLKFMTKNVGTDGWSKVETRFLELAVDGKLPKTRFSQCIGMNDSREFAGELFDALARRRGITSASITKDELREFWEQITDQSFDSRLQTFFDMVDKNADGRITEEEVKIIALSASANKLSKLQERAEEYAALIMEELDPDNLGFVEVYNLEMLLLQAPAQSTHMNTDSRVLSQMLSQKLVPTKEHNPIKRGLRSLSYFIEDNWKRLWIIALWLCICAGLFTWKFIQYKNRAVFHVMGYCVTTAKGAAETLKFNMALILLPVCRNTITWLRSRTKLGMAVPFDDNINFHKVIAFGVAIGVGLHAISHLTCDFPRLLHATDAEYEPMKPFFGQQRPNNYWWFVKGTEGWTGIVIVVLMAIAYTLAQPWFRRSRLNLPKPLKKLTGFNAFWYSHHLFVIVYALLIVHGYFLYLTKHWYKKTTWMYLAIPMLIYACERLLRAFRSGYKSVKILKVAVYPGNVLALHMSKPQGFKYYSGQYIFVNCSDVSPFQWHPFSITSAPGDDYVSVHIRTLGDWTSQLKAVFAKACQPASGDQSGLLRADMLQGNNIPRMPKLLIDGAYGAPAQDYKNYEVILLVGLGIGATPLISILKDVLNNIKQQKDIEEGMVESGVKNNKRKPFATNRAYFYWVTREQGSFEWFRGVMDEVAENDKDGVIELHNYCTSVYEEGDARSALITMLQSLQHAKSGVDIVSGTRVKTHFARPNWRKVFKQAALKHPNKTGVFYCGAHALVGELKRLSLDFSRKTNTKFDFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTCAGCAAGAGGAACACGAGTCGTGGTCGGAGACGGAGAGCACGGGGAGCCGGAGCACACGTGTGGGCTTCAGTGGGCCGCTGAGCGGCCCATTGGTGTCCAACAACAGGAAG
AAGTTGAGCGCCAGGTTCAAGGACGACGATGATGACTTGGTCGAGATCACCTTGGACGTTCGCGACGACACCGTTTCCGTCCAGAACATTCGAGGCGGAGACCCAGAGACGGCACTCCTC
GCTAGCCGCCTCGAGAAGCGGCCGTCCTCGCTGGGTGTCCGCCTCAGACAGGTGTCACAGGAACTGAAACGCATGACTTCCTCTCAGAAGTTCGACAAAGTTGATAGGAGCAAGTCCGGT
GCCGCACGTGCACTCAAAGGACTCAAGTTTATGACCAAAAATGTCGGAACTGATGGTTGGTCTAAGGTTGAGACCCGCTTCCTTGAGTTGGCCGTCGATGGAAAGCTCCCCAAAACCCGG
TTTAGCCAGTGCATAG
GTACTTCTTATTTTTATTCTTAATTTTTTAGTAACTGATTAATTATTAGTCGATCAATGTTACTGTTGTTGGTGAAGTAATTAATTAGTTAATGACGAAAACTA
ATTAAACTAGGTATGAACGACTCGAGAGAGTTTGCTGGAGAGTTATTTGATGCATTAGCTCGTCGTCGAGGCATAACATCCGCTTCCATTACCAAGGATGAGTTGCGTGAATTCTGGGAA
CAAATTACTGATCAGAGCTTTGATTCAAGGCTGCAGACCTTCTTTGACAT
GTAAGATAATTATTATGATAGCTTCATTAATTAGGACATGCATGCTATCAATCATCACTGATAGTATGTA
TAATTATGTTGCATGCACATTAAAAAAAATACATATTAAAATATAAAATATATTTTTAAAATGAATTAAATAAATATGTTCTTGTGACCAATTTGATGAGTAACACCTAACATCTTTTAT
AATCAAATGTGGTAGCTATAAGACCTAGGTGTTAATGGAGACTAATTAAGGTGCTCATTAATTTTTTAAAGACCATACAGATTAATTACAGATTATAGACAATAGAGAGATCGTCAGAGA
TCGTTTGACTTTGCTTTCTAATTATTTGTATTTATCTATCAGTGGTGGAAAAACTAACGCCGCACTTGATGCAACTTTCATGTGAAGAAATGATGATTGAGTTTATATAATATTATATAT
TATTGTCACCCACCCATAAGATATACTAGGGAATTATTGTTCACAAATTTGTGGAGTTATGAAAGTTGTCATTAGGCAAATTAGAGTATTAACAACCATCAATTAATAAATGATAATTCT
AAAATAATCTTGTTACATATAGATTTTCTTATAGTGGATATCATTTTATGACATCAGTATTTTTTAATAATTTATACATATTTTCTTATTTTATTAATTAAAAATAATTTAATTATACAA
TTAATTAATAATAATTATATTTTTATTCTGCTGTTATGAGTGTTTTAGTATACCAATATAGTATTATCAATTTTGAAATAGTTATTATTCGAAGTATAAGATTATGAAAGTATTCTCAAT
GTTTCTAGGTTTATGTAGTAGAACTAACCGAAGGGTGCTTATCATTTTTAAAACCTAACTTTACTAAATCACGCAATCATAATAAGCTTATAATTTAATAATTTTTAAAAGCTACATATT
ATAACCTGTCAAATGGCACCCAAGTAGTAGTTAAAAGATCAGATCACTATCTTTTGGTTGAATTGCTCTATACGAATTATTTTTCAATAAAAAATTACTTAAAAACATTTTGAAGAATTA
TTTTTCGATCTCCTGTGTACAACTATACATGACGCGGGATTTTAATCCATCATTCAAACCTTAGAAAATTTGTTGCAAGATTATTATTGTTATTATTATTAAGATAGTGGAACGGTCTAG
GGGTTAAGCTGGAAAGTGAACCAAAAAGATAAATTGAACTTAAATAGGAAATTAATGGTTGGTCCCATTGAAGAGAAGAAAAAAAAGAATGAATCAGCGTTTGCTGCACCAAACCCAAAG
GGCTTTAGGAACAAGAACCAGTCAACGCTGTGTTGGGTTGATAACTGAACAAAAAAAATATACATACACGGAATTTGTCTCTCTATTGACTATTGAGTATCATTTGGAAAACAACATATG
TACGCATGAATGTCACATAAAGATATAATTATTTATAAGTTCTCTTCTTATCAGTTTACATTATTAGAATAAATAATATTTTAATATAATTTTAAAATTTTATATTCAAATGAGTCCTAT
GATGACAATGTCATAGTCAAAATATGAAAACATATATTATTGAGAATCAAATGTCAATGCTATATCTTAGATTAGGTGATTTAGGTCCACACCGACATTTTTGCTGACTATTGATAAAAT
TGAACTCATGCCAGGGTGGACAAGAATGCTGACGGACGAATTACCGAAGAAGAAGTTAAAGAGGTAAGCAATAATATACAACTATACTTACCGAAATTAATTTTTATATGTGGAGATATG
AACGTCGTTAAACTGTTGCATGATTATTGTTTTTACAGATTATCGCTTTGAGCGCTTCCGCTAATAAGCTTTCAAAATTACAAGAGCGTGCGGAGGAATATGCAGCTCTTATCATGGAAG
AGTTGGATCCAGACAACCTTGGATTCGTCGAGGTTTACAACTTGGAAATGCTGCTTCTGCAAGCACCAGCGCAATCAACACACATGAACACAGATAGCAGGGTGCTGAGCCAAATGCTGA
GCCAGAAACTAGTCCCAACAAAAGAACACAACCCAATCAAGCGTGGGTTGCGGTCACTGTCCTACTTCATCGAGGACAATTGGAAGCGTCTCTGGATTATAGCTCTCTGGCTCTGCATTT
GCGCAGGCCTCTTCACTTGGAAGTTCATCCAGTACAAGAACCGCGCAGTCTTCCACGTCATGGGCTACTGTGTCACCACGGCCAAGGGAGCCGCCGAGACTCTCAAGTTCAACATGGCCT
TAATCCTCTTACCTGTATGCAGAAACACCATCACCTGGCTCAGGAGCAGGACCAAGCTAGGCATGGCCGTTCCCTTTGATGACAACATCAACTTTCACAAG
GTATGTATGTTCTTATTTT
ATATCTTAAGTTGAGTTTAGTTTTGATAACGGGATAAAACAAGACATTAAAAATAAAATATAAAAATGAGTATTTTTATATTTTGTTAGGTGATAAATTAAAATAAATTATAAAAATTTA
ATTTAATTTTTTTATTTAAAAAATTTAAGAAAAAAATATAACAATAAAAAATTAATAAAATAATAAAAAAATAAAACATAAATTATGTTTTGTTGTTAGTGTTTCTAACAAAATATATTA
ATTTAATATAATTTTATATCTTTATAAACAAAAACAGGCTTAGTATCTTTTCCATAACATAACTATAACTGTGGTATCTTTGTTCAGGTGATTGCTTTTGGGGTTGCTATTGGGGTTGGG
TTGCATGCAATTTCGCATCTAACATGCGATTTCCCAAGGCTGTTACACGCGACGGACGCGGAATATGAGCCAATGAAGCCATTTTTTGGGCAGCAAAGGCCAAACAATTATTGGTGGTTT
GTGAAGGGGACAGAGGGTTGGACAGGGATAGTGATTGTGGTGCTTATGGCAATAGCATACACATTGGCACAACCTTGGTTCCGAAGAAGCAGGTTGAATCTTCCTAAACCTCTCAAGAAA
CTCACTGGCTTCAACGCCTTTTGGTACTCTCATCACCTCTTCGTCATTGTCTATGCTCTTTTAATCGTTCATGGATACTTCCTTTACCTCACCAAGCATTGGTATAAGAAAACG
GTATGC
ATCAATTTATTACATTATTTTCCTTATTCATTCATTCTTTTCTTCTTTTCTAAACTTATTGAACTATTTGTACAGACTTGGATGTATCTTGCTATTCCCATGCTCATATACGCATGTGAG
CGCCTACTTCGTGCTTTTAGATCTGGCTACAAAAGTGTCAAGATTTTGAAG
GTACATTGCCTTGTCTACTACTGCTTTTGTTTAAGATAATTAAATAATGCACTAAACTATATAAACTTG
TCAATGTTCCAGGTTGCAGTATACCCAGGAAATGTCTTGGCCTTGCATATGTCAAAACCACAAGGGTTTAAGTACTATAGCGGACAGTATATTTTCGTTAACTGTTCAGATGTCTCCCCA
TTTCAATG
GTAAAATTCTTCTTCTTATTTATTAACGAGAAATGTATTGCTATTAGTTTGTTATAACTAACTGACATGTATGTATATGTATAGGCATCCTTTCTCTATTACATCAGCTCCG
GGAGATGATTACGTAAGCGTCCATATTCGGACTTTGGGTGACTGGACTTCACAGCTTAAGGCGGTTTTCGCGAAGGCGTGTCAACCGGCAAGTGGGGACCAAAGTGGTCTTCTAAGAGCA
GATATGTTACAGGGCAACAACATACCAAGGATGCCGAAGCTGTTGATTGATGGGGCATATGGAGCTCCAGCACAAGACTACAAGAACTACGAAGTGATTCTTCTTGTGGGGCTAGGAATT
GGTGCAACACCATTGATTAGTATACTGAAAGATGTGTTAAACAACATAAAGCAACAGAAAGACATAGAAGAAGGGATGGTGGAAAGTGGTGTTAAGAACAACAAGAGAAAACCATTCGCC
ACAAACAGGGCTTATTTCTACTGGGTGACACGTGAGCAGGGGTCGTTCGAGTGGTTCAGGGGTGTGATGGATGAGGTTGCAGAGAATGACAAGGACGGAGTGATTGAGCTTCATAACTAT
TGTACAAGTGTGTATGAAGAAGGAGATGCTAGATCGGCTTTGATCACAATGCTTCAGTCCCTCCAACATGCTAAGAGTGGTGTGGATATTGTTTCAGGGACAAGGGTCAAGACCCACTTT
GCTAGGCCTAATTGGCGCAAGGTCTTTAAGCAAGCTGCTCTCAAACACCCCAACAAAACAGTTG
GTAAGTTCATTTTCTTGATATCTCTACTTATATGGAATTTAAATTATATTTTGTTA
GGAAATATAAAAAAATGAGTTATGTTAAAGTGAACACTAGAATCAACTATCAAATTCAGCCACCAGTATAAAATATATGTTAGAATATAAATACACATTAAAAATAAATTAAATTATATA
TATATTTATACACAAATACATTAGCTGATTTTAGTAGTTGATTTTGGTTTACAAATAGTATTTTTTTTCAAAAATACTATATATACATAAAAAAATAGTTTTAATTAATTGTCATGTTTA
TTTAATTTATTTTATATATATAAAGGATGTTAGAGGATTATTAGAATATATTATTTTTAATTATAAATTAAGCATCAATATTTAAAAATATAAAATAAAATATGTTGTTAGATTATTAAA
CTAAAAAATTTGATTAAAAAAATTAAATTTATAACTAAATAATAATTAAAATTATTAAAGTTTGATAATTTTTAATATACACTAAATACTATTGAATATATGAGTCAATATGACTATTAT
GTTTACATTCTCTATTTACTCCTTTTTAGGTGTATTTTACTGTGGAGCTCATGCATTGGTTGGAGAATTAAAGAGGCTTTCTCTGGACTTTTCTAGGAAAACCAACACTAAGTTCGATTT
TCATAAAGAGAATTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTCAGCAAGAGGAACACGAGTCGTGGTCGGAGACGGAGAGCACGGGGAGCCGGAGCACACGTGTGGGCTTCAGTGGGCCGCTGAGCGGCCCATTGGTGTCCAACAACAGGAAG
AAGTTGAGCGCCAGGTTCAAGGACGACGATGATGACTTGGTCGAGATCACCTTGGACGTTCGCGACGACACCGTTTCCGTCCAGAACATTCGAGGCGGAGACCCAGAGACGGCACTCCTC
GCTAGCCGCCTCGAGAAGCGGCCGTCCTCGCTGGGTGTCCGCCTCAGACAGGTGTCACAGGAACTGAAACGCATGACTTCCTCTCAGAAGTTCGACAAAGTTGATAGGAGCAAGTCCGGT
GCCGCACGTGCACTCAAAGGACTCAAGTTTATGACCAAAAATGTCGGAACTGATGGTTGGTCTAAGGTTGAGACCCGCTTCCTTGAGTTGGCCGTCGATGGAAAGCTCCCCAAAACCCGG
TTTAGCCAGTGCATAG
GTATGAACGACTCGAGAGAGTTTGCTGGAGAGTTATTTGATGCATTAGCTCGTCGTCGAGGCATAACATCCGCTTCCATTACCAAGGATGAGTTGCGTGAATTC
TGGGAACAAATTACTGATCAGAGCTTTGATTCAAGGCTGCAGACCTTCTTTGACAT
GGTGGACAAGAATGCTGACGGACGAATTACCGAAGAAGAAGTTAAAGAGATTATCGCTTTGAGC
GCTTCCGCTAATAAGCTTTCAAAATTACAAGAGCGTGCGGAGGAATATGCAGCTCTTATCATGGAAGAGTTGGATCCAGACAACCTTGGATTCGTCGAGGTTTACAACTTGGAAATGCTG
CTTCTGCAAGCACCAGCGCAATCAACACACATGAACACAGATAGCAGGGTGCTGAGCCAAATGCTGAGCCAGAAACTAGTCCCAACAAAAGAACACAACCCAATCAAGCGTGGGTTGCGG
TCACTGTCCTACTTCATCGAGGACAATTGGAAGCGTCTCTGGATTATAGCTCTCTGGCTCTGCATTTGCGCAGGCCTCTTCACTTGGAAGTTCATCCAGTACAAGAACCGCGCAGTCTTC
CACGTCATGGGCTACTGTGTCACCACGGCCAAGGGAGCCGCCGAGACTCTCAAGTTCAACATGGCCTTAATCCTCTTACCTGTATGCAGAAACACCATCACCTGGCTCAGGAGCAGGACC
AAGCTAGGCATGGCCGTTCCCTTTGATGACAACATCAACTTTCACAAG
GTGATTGCTTTTGGGGTTGCTATTGGGGTTGGGTTGCATGCAATTTCGCATCTAACATGCGATTTCCCAAGG
CTGTTACACGCGACGGACGCGGAATATGAGCCAATGAAGCCATTTTTTGGGCAGCAAAGGCCAAACAATTATTGGTGGTTTGTGAAGGGGACAGAGGGTTGGACAGGGATAGTGATTGTG
GTGCTTATGGCAATAGCATACACATTGGCACAACCTTGGTTCCGAAGAAGCAGGTTGAATCTTCCTAAACCTCTCAAGAAACTCACTGGCTTCAACGCCTTTTGGTACTCTCATCACCTC
TTCGTCATTGTCTATGCTCTTTTAATCGTTCATGGATACTTCCTTTACCTCACCAAGCATTGGTATAAGAAAACG
ACTTGGATGTATCTTGCTATTCCCATGCTCATATACGCATGTGAG
CGCCTACTTCGTGCTTTTAGATCTGGCTACAAAAGTGTCAAGATTTTGAAG
GTTGCAGTATACCCAGGAAATGTCTTGGCCTTGCATATGTCAAAACCACAAGGGTTTAAGTACTATAGC
GGACAGTATATTTTCGTTAACTGTTCAGATGTCTCCCCATTTCAATG
GCATCCTTTCTCTATTACATCAGCTCCGGGAGATGATTACGTAAGCGTCCATATTCGGACTTTGGGTGACTGG
ACTTCACAGCTTAAGGCGGTTTTCGCGAAGGCGTGTCAACCGGCAAGTGGGGACCAAAGTGGTCTTCTAAGAGCAGATATGTTACAGGGCAACAACATACCAAGGATGCCGAAGCTGTTG
ATTGATGGGGCATATGGAGCTCCAGCACAAGACTACAAGAACTACGAAGTGATTCTTCTTGTGGGGCTAGGAATTGGTGCAACACCATTGATTAGTATACTGAAAGATGTGTTAAACAAC
ATAAAGCAACAGAAAGACATAGAAGAAGGGATGGTGGAAAGTGGTGTTAAGAACAACAAGAGAAAACCATTCGCCACAAACAGGGCTTATTTCTACTGGGTGACACGTGAGCAGGGGTCG
TTCGAGTGGTTCAGGGGTGTGATGGATGAGGTTGCAGAGAATGACAAGGACGGAGTGATTGAGCTTCATAACTATTGTACAAGTGTGTATGAAGAAGGAGATGCTAGATCGGCTTTGATC
ACAATGCTTCAGTCCCTCCAACATGCTAAGAGTGGTGTGGATATTGTTTCAGGGACAAGGGTCAAGACCCACTTTGCTAGGCCTAATTGGCGCAAGGTCTTTAAGCAAGCTGCTCTCAAA
CACCCCAACAAAACAGTTG
GTGTATTTTACTGTGGAGCTCATGCATTGGTTGGAGAATTAAAGAGGCTTTCTCTGGACTTTTCTAGGAAAACCAACACTAAGTTCGATTTTCATAAAGAG
AATTTTTAG

Retrieve as FASTA