Entry information : AdurRboh04(aradu.Aradu.J2RZP.1)
Entry ID 16304
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-23 (Christophe Dunand)
Peroxidase information: AdurRboh04(aradu.Aradu.J2RZP.1)
Name AdurRboh04(aradu.Aradu.J2RZP.1)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Arachis duranensis    [TaxId: 130453 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdurRboh04
start..stop
S start..stop
AipaRboh07 1762 0 1..880 1..885
NschRboh01 1570 0 1..880 1..929
LaRboh02 1473 0 8..880 10..902
CausRboh01 1464 0 3..880 5..928
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 167..638 472 N° 2 714..876 163 N° 3 968..1016 49 N° 4 1101..1214 114
N° 5 1295..1717 423 N° 6 1781..2164 384 N° 7 2235..2446 212 N° 8 2567..2669 103
N° 9 2767..2840 74 N° 10 3680..4218 539 N° 11 4509..4618 110  
join(167..638,714..876,968..1016,1101..1214,1295..1717,1781..2164,2235..2446,256 7..2669,2767..2840,3680..4218,4509..4618)


exon

Literature and cross-references AdurRboh04(aradu.Aradu.J2RZP.1)
Cluster/Prediction ref. Genebank:   107480142
Protein sequence: AdurRboh04(aradu.Aradu.J2RZP.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   880
PWM (Da):   %s   99495.08  
PI (pH):   %s   9.19
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKEGADSADLHHRESDIELIGAEKSQDERNLVEVTMDIQGGSVALRSVKSVDELVEDEKSGLIGRKLEKKASFGASVVQNATNRMKQLKRLASFSKPSPSKKFDRTKSTVAHALSGLKFISKTDGGAGWDEVQIRFDKLTAATDGNLPRSLFGKCIGMNEQSKAYAEKLFDTLARQRGIQGDSINKLQLRDFWDRISDQSFDNRLRTFFDMVDKDADGRITEEEIKIICLSATANNLTNIQKQAEEYAALIMEELDPDDAGYIMIDNLETLLLHGPDQTTRGDSKYLSQMLSQKLTPTFMNNPIRRWYRDSKYFLQDNWQRVWVLVLWICIMLGLFAYKFVQYRNRAAYEVMGHCVCMAKGAAETLKLNMALILLPVCRNTITWLRNRTKLGVAVPFDDNLNFHKVIAVAIAIGVAVHAIYHLTCDFPRLLHASPEKYELMKPFFGDKPSNYLYYVTSWEGVTGIVMVLLMAIAFTLANPRFRRGRAKLPKHLQKLTGFNAFWYSHHLFVIVYVLLVVHGIKLYLTHKWYKKTTWMYLAVPIIIYALERLIRALRSSTESVKILKVAVYPGNVLSLHMSKPPGFSYKSGQYMFVNCAAVSPFEWHPFSITSAPDDNYLSVHIKILGDWTGNLKAKFVACQPPLNGQSGLLRADCIKGDSQPSTFPKVQVDGPYGAPAQDYREYEVVLLVGLGIGATPMISILKDIVNNFKVMDEEYGEGELGGSRSATNQQKKARLEEFKTRRAYFYWVTREQGSFDWFKGVMNEAAEEDHRGAIELHSYCTSVYEEGDARSALITMLQSINHAKSGVDIVSGTRVMSHFAKPNWRSVYKRIALNHPHARGVFYCGSPALTKQLRQLSLDFSHNTSTKFEFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGGAGGGTGCAGATTCAGCAGATCTTCACCACCGTGAATCTGATATAGAACTCATTGGTGCTGAAAAATCCCAGGATGAAAGAAACCTGGTTGAGGTGACTATGGATATTCAA
GGTGGCTCAGTTGCCTTACGCAGCGTTAAAAGTGTTGATGAATTGGTAGAAGATGAGAAATCAGGTTTGATTGGTAGGAAGCTGGAGAAGAAAGCCTCGTTTGGTGCATCTGTTGTGCAA
AATGCAACTAACCGTATGAAGCAGCTGAAGCGTTTGGCTTCATTTTCAAAGCCATCCCCTTCAAAGAAATTCGACAGGACCAAGTCCACTGTGGCTCATGCTCTTTCTGGGCTCAAGTTT
ATCAGCAAAACTGATGGTGGTGCAGGTTGGGATGAGGTTCAGATCAGGTTTGACAAGCTTACTGCTGCCACTGATGGAAATCTTCCCCGTTCTCTCTTTGGCAAATGCATAG
GTATTGCT
CTTCTGTTATCTTGCTTTTCAAATCATACACAGTAATTGCTAATCACATTCTTCAATCTGCCTACAGGAATGAACGAGCAGTCTAAGGCGTATGCAGAGAAGCTTTTCGATACTCTTGCC
CGCCAGAGGGGTATTCAGGGTGATTCCATTAACAAGCTCCAGTTGAGGGATTTCTGGGACCGTATTTCAGATCAGAGCTTTGATAATAGGCTCAGAACATTCTTTGACAT
GTAACTTATT
TATTTGTTTATTATCTTCCAGTCTTGGTCATTGGTCAATATGAACATTGGAACATCAAGAACCTTAATTTTTGGAATGCAGGGTTGATAAAGATGCAGATGGCAGGATCACTGAGGAAGA
AATTAAAGAG
GTATGGCCTTACTTCACTAACTGATCCAGATTTGAGGTTCACATAGACTACTACTTGACCGAATGCTAATAATTATGGTCTCAGATCATATGTCTAAGCGCCACAGCAAA
CAACCTCACAAACATACAAAAGCAAGCAGAAGAATATGCAGCTTTGATAATGGAAGAACTAGACCCTGATGACGCTGGATATATAATG
GTAAATCCAAAAACATCTCCATTCGATATCAT
TTGATTCTTATCTAGGCCTATGACAAGTTTAACGGTTTGGCCAAACAGATAGACAACTTGGAGACACTGTTATTACACGGACCAGATCAAACTACAAGAGGAGACAGCAAGTACCTGAGC
CAAATGCTAAGCCAAAAGCTTACACCTACTTTTATGAACAATCCTATTAGAAGATGGTACAGAGATAGCAAGTACTTCTTGCAGGACAATTGGCAGAGAGTATGGGTTTTGGTGCTATGG
ATTTGCATCATGTTAGGTCTCTTTGCTTATAAATTTGTGCAGTATCGGAATAGAGCAGCGTATGAGGTGATGGGCCACTGTGTATGCATGGCAAAAGGTGCAGCTGAGACACTTAAATTG
AACATGGCTCTTATTCTGTTACCTGTTTGCCGAAACACCATCACCTGGCTCAGGAACAGAACCAAGCTAGGCGTTGCGGTTCCTTTTGATGACAATCTCAACTTCCACAAG
GTAAATGCG
AAGCATAACTTGTTGTTTAGTTGGGTTATATCATAAACTTTGTGGTTTGTGCAGGTGATAGCTGTGGCAATAGCAATTGGTGTTGCGGTACATGCTATATATCATCTTACTTGTGATTTT
CCTCGCCTTCTTCATGCAAGCCCTGAAAAGTACGAGCTCATGAAACCTTTTTTTGGAGACAAACCATCAAACTATTTGTACTATGTTACATCATGGGAAGGAGTAACAGGGATTGTAATG
GTTCTGCTAATGGCAATAGCCTTTACATTGGCCAACCCCAGATTCAGAAGAGGCCGGGCCAAACTACCCAAACATCTACAGAAACTCACAGGTTTCAATGCCTTCTGGTACTCCCATCAC
CTCTTCGTAATCGTCTATGTCCTATTGGTTGTGCATGGAATCAAACTTTACTTGACCCACAAATGGTACAAGAAAACG
GTAAGCCCCTTCTTCATGTCTATTTAGTAAGAGATGATCGAT
AAGTAATAGGCATCATTGTGTTGTGTAGACTTGGATGTATTTGGCTGTTCCTATCATCATTTATGCATTGGAAAGACTGATTAGAGCACTAAGATCGAGCACAGAATCTGTGAAAATATT
GAAGGTGGCTGTTTATCCCGGCAATGTGTTATCACTGCATATGTCAAAGCCTCCAGGGTTTAGCTACAAGAGTGGACAATACATGTTCGTCAATTGCGCTGCTGTCTCTCCATTTGAATG
GTATGCATTAATCAAATAGATTCTATTGACTGAATCTTAAGCTTTGTATATCTTTTTATTCTGTCAATTCTGATCTTCATTTCCACCTTTTAAACATTAATTTCCTTTGTGGTTTCACAG

GCATCCATTTTCCATAACCTCCGCCCCGGATGATAATTACCTAAGCGTTCATATTAAAATACTTGGTGATTGGACTGGAAATCTGAAAGCCAAATTCGTTAAG
GTGAATTAATCTTTATT
TGTTTATTTATGTTCCTATCAAAATATTGGTTTCTCCTATGGTAAGTAACTAAGTCTATTGTTTTGCTAAATTCTATCAGGCGTGCCAGCCACCCCTCAATGGCCAGAGTGGACTTCTAA
GAGCTGACTGCATCAAAGGAGACAGCCAACCGAG
GTGAGCTCGAAGAAGTGGGGAAATTATGATGGCAAGCGACTAATATTTTACAAAACCATCTTGTTAAAACTAGCTATTTTGGACCT
ATTTAGGTGTTTATGCATTTTATCTATCTATTAATTATTAAGAAAATTGAATAAAATGTCAATATTTCAATGGATAAAATGTATAAACACTTAAAAATTATCACAAAAAAATGTTCAAAT
AATATTTTTAAATGTTTTTTCATGTGATAAGGGCTTCCAATAATAATAATAATAATAATACCGGAAATTTTATTAAAACTAGAGTCTTCAATAGTTTATTTCCTTTTAAAAAAAAGTAAT
GATATCCAGGCTGCTTTAGATCCTGCATAACATATTTATTCCATTAGCTAAGTGATCCAGATGACCAGATCCAATAATTGTATATAAGTTCTTATTTTATACTGTATATTTAATATATGT
TCTAAAAATATTTATAATCAGTTTTTTATTGATAACATTTAAAAATCATACATCCAAGTATTTCTCAACAAAGTTGTTTGATTTAAAATTAATTGGCAAAAATCAAAGCGGGGACTTGTT
TGTCCTTGTCTTGTTTTTGGACTTAGGAATACAATAATTGGAACAATCGAGATTCCCACGCATCTTCTCACATGTTTGTGATTAATAATCAGATAAAAATAGTTAAAGAGTGGTTGTTGT
CTGGACTTAGGAAAGAAAAAGAAAAGATTAGGTGGATAAGGATACCAACTGAAAACTACTTAAGCTTAATTAATTAGTGTGGTGATAAAGTAGCAGTGCGTACTGACTTGACTAAAAATG
GATCTTGTATTTTGATTATGATATCATTTGCAGTACTTTCCCAAAAGTCCAAGTTGATGGTCCGTATGGAGCGCCAGCGCAAGACTACAGGGAGTATGAGGTGGTTCTGTTAGTGGGGCT
GGGAATTGGGGCTACCCCAATGATAAGTATACTGAAGGACATAGTTAACAATTTCAAGGTGATGGACGAGGAGTACGGAGAAGGTGAATTAGGTGGTTCTAGATCAGCCACAAACCAACA
AAAGAAGGCAAGGTTAGAGGAGTTCAAGACAAGGAGAGCATACTTCTATTGGGTTACCAGGGAACAGGGTTCCTTTGATTGGTTTAAAGGGGTGATGAACGAAGCAGCTGAAGAGGACCA
CAGAGGAGCCATTGAGCTCCACAGCTACTGCACTAGCGTCTATGAAGAAGGTGACGCTCGATCTGCTCTTATCACTATGCTACAGTCTATAAACCATGCAAAGAGTGGCGTGGACATTGT
CTCTGGCACTCGTGTCATGTCTCACTTCGCCAAACCTAATTGGCGCAGTGTCTACAAGCGCATTGCGCTGAACCATCCACATGCCCGCGTTG
GTGAGTCTCCACTTCATCATCTCACGTT
CCTTTTATTTCTTTCTTTAACTACTCATCGTGAAAAACGCTTCAATAATTGCTATCAATTACAGTCGTATTATTATCTTTATTTTGCCAAAAAGATGGCCACACATTAGTGTTAAATTCA
AAACTAGCATAAAGCAGTCTCTCTCTGGACTTTGGAGATGCTTTCGATCGACATCAATTAGTATATATGAGTTTTACGTGTACGGAGAAAACTCTAGTTTTTTATCAAGAGATAAAGATA
AGAGTGCTTTATTGTAATGCAGGGGTCTTTTACTGTGGGTCACCCGCTCTCACTAAGCAGCTTCGTCAGCTGTCTTTGGATTTCTCTCACAACACCTCCACCAAATTTGAATTCCATAAA
GAAAATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGGAGGGTGCAGATTCAGCAGATCTTCACCACCGTGAATCTGATATAGAACTCATTGGTGCTGAAAAATCCCAGGATGAAAGAAACCTGGTTGAGGTGACTATGGATATTCAA
GGTGGCTCAGTTGCCTTACGCAGCGTTAAAAGTGTTGATGAATTGGTAGAAGATGAGAAATCAGGTTTGATTGGTAGGAAGCTGGAGAAGAAAGCCTCGTTTGGTGCATCTGTTGTGCAA
AATGCAACTAACCGTATGAAGCAGCTGAAGCGTTTGGCTTCATTTTCAAAGCCATCCCCTTCAAAGAAATTCGACAGGACCAAGTCCACTGTGGCTCATGCTCTTTCTGGGCTCAAGTTT
ATCAGCAAAACTGATGGTGGTGCAGGTTGGGATGAGGTTCAGATCAGGTTTGACAAGCTTACTGCTGCCACTGATGGAAATCTTCCCCGTTCTCTCTTTGGCAAATGCATAG
GAATGAAC
GAGCAGTCTAAGGCGTATGCAGAGAAGCTTTTCGATACTCTTGCCCGCCAGAGGGGTATTCAGGGTGATTCCATTAACAAGCTCCAGTTGAGGGATTTCTGGGACCGTATTTCAGATCAG
AGCTTTGATAATAGGCTCAGAACATTCTTTGACAT
GGTTGATAAAGATGCAGATGGCAGGATCACTGAGGAAGAAATTAAAGAGATCATATGTCTAAGCGCCACAGCAAACAACCTCACA
AACATACAAAAGCAAGCAGAAGAATATGCAGCTTTGATAATGGAAGAACTAGACCCTGATGACGCTGGATATATAATG
ATAGACAACTTGGAGACACTGTTATTACACGGACCAGATCAA
ACTACAAGAGGAGACAGCAAGTACCTGAGCCAAATGCTAAGCCAAAAGCTTACACCTACTTTTATGAACAATCCTATTAGAAGATGGTACAGAGATAGCAAGTACTTCTTGCAGGACAAT
TGGCAGAGAGTATGGGTTTTGGTGCTATGGATTTGCATCATGTTAGGTCTCTTTGCTTATAAATTTGTGCAGTATCGGAATAGAGCAGCGTATGAGGTGATGGGCCACTGTGTATGCATG
GCAAAAGGTGCAGCTGAGACACTTAAATTGAACATGGCTCTTATTCTGTTACCTGTTTGCCGAAACACCATCACCTGGCTCAGGAACAGAACCAAGCTAGGCGTTGCGGTTCCTTTTGAT
GACAATCTCAACTTCCACAAG
GTGATAGCTGTGGCAATAGCAATTGGTGTTGCGGTACATGCTATATATCATCTTACTTGTGATTTTCCTCGCCTTCTTCATGCAAGCCCTGAAAAGTAC
GAGCTCATGAAACCTTTTTTTGGAGACAAACCATCAAACTATTTGTACTATGTTACATCATGGGAAGGAGTAACAGGGATTGTAATGGTTCTGCTAATGGCAATAGCCTTTACATTGGCC
AACCCCAGATTCAGAAGAGGCCGGGCCAAACTACCCAAACATCTACAGAAACTCACAGGTTTCAATGCCTTCTGGTACTCCCATCACCTCTTCGTAATCGTCTATGTCCTATTGGTTGTG
CATGGAATCAAACTTTACTTGACCCACAAATGGTACAAGAAAACG
ACTTGGATGTATTTGGCTGTTCCTATCATCATTTATGCATTGGAAAGACTGATTAGAGCACTAAGATCGAGCACA
GAATCTGTGAAAATATTGAAGGTGGCTGTTTATCCCGGCAATGTGTTATCACTGCATATGTCAAAGCCTCCAGGGTTTAGCTACAAGAGTGGACAATACATGTTCGTCAATTGCGCTGCT
GTCTCTCCATTTGAATG
GCATCCATTTTCCATAACCTCCGCCCCGGATGATAATTACCTAAGCGTTCATATTAAAATACTTGGTGATTGGACTGGAAATCTGAAAGCCAAATTCGTTAAG
GCGTGCCAGCCACCCCTCAATGGCCAGAGTGGACTTCTAAGAGCTGACTGCATCAAAGGAGACAGCCAACCGAGTACTTTCCCAAAAGTCCAAGTTGATGGTCCGTATGGAGCGCCAGCG
CAAGACTACAGGGAGTATGAGGTGGTTCTGTTAGTGGGGCTGGGAATTGGGGCTACCCCAATGATAAGTATACTGAAGGACATAGTTAACAATTTCAAGGTGATGGACGAGGAGTACGGA
GAAGGTGAATTAGGTGGTTCTAGATCAGCCACAAACCAACAAAAGAAGGCAAGGTTAGAGGAGTTCAAGACAAGGAGAGCATACTTCTATTGGGTTACCAGGGAACAGGGTTCCTTTGAT
TGGTTTAAAGGGGTGATGAACGAAGCAGCTGAAGAGGACCACAGAGGAGCCATTGAGCTCCACAGCTACTGCACTAGCGTCTATGAAGAAGGTGACGCTCGATCTGCTCTTATCACTATG
CTACAGTCTATAAACCATGCAAAGAGTGGCGTGGACATTGTCTCTGGCACTCGTGTCATGTCTCACTTCGCCAAACCTAATTGGCGCAGTGTCTACAAGCGCATTGCGCTGAACCATCCA
CATGCCCGCGTTG
GGGTCTTTTACTGTGGGTCACCCGCTCTCACTAAGCAGCTTCGTCAGCTGTCTTTGGATTTCTCTCACAACACCTCCACCAAATTTGAATTCCATAAAGAAAATTTC
TGA

Retrieve as FASTA